Skip Navigation LinksHome > February 20, 2009 - Volume 23 - Issue 4 > Dynamic patterns of human immunodeficiency virus type 1 inte...
AIDS:
doi: 10.1097/QAD.0b013e328323da60
Basic Science: Concise Communication

Dynamic patterns of human immunodeficiency virus type 1 integrase gene evolution in patients failing raltegravir-based salvage therapies

Canducci, Filippoa; Sampaolo, Michelaa; Marinozzi, Maria Chiaraa; Boeri, Enzob; Spagnuolo, Vincenzoc; Galli, Andreac; Castagna, Antonellac; Lazzarin, Adrianoa,c; Clementi, Massimoa,b; Gianotti, Nicolac

Free Access
Article Outline
Collapse Box

Author Information

aUniversità Vita-Salute San Raffaele, Italy

bDiagnostica e Ricerca San Raffaele, Italy

cDivisione di Malattie Infettive, Istituto Scientifico San Raffaele, Milan, Italy.

Received 19 September, 2008

Revised 14 November, 2008

Accepted 22 November, 2008

Correspondence to Filippo Canducci, MD, PhD, Università Vita-Salute San Raffaele, Via Olgettina 58, Milan, Italy. Tel: +390226434284; e-mail: canducci.filippo@hsr.it

Collapse Box

Abstract

Objective: Evaluate HIV-1 subtype B integrase gene evolution in patients failing raltegravir (RAL)-based savage regimens by clonal analysis of the replicating viral quasispecies.

Design: Seven triple class failure HIV-1 (subtype B)-infected patients, followed at San Raffaele Hospital and enrolled in the RAL Expanded Access Program (MK0518-023), were evaluated. Patients were followed up for 24–48 weeks and due to the absence of other active drugs, RAL was maintained in their regimens even if resistance mutations were detected.

Methods: Immunologic and virologic parameters were recorded every 4 weeks, and amplification and clonal analysis of viral populations were performed at baseline and every 4–12 weeks in all patients.

Results: Resistance to RAL appeared initially associated with selection of single variants (Y143R, Q148R N155H) in the majority of patients; however, in three patients, complex patterns of viral mutations were observed. The clonal analysis of viral quasispecies allowed to describe the evolution of each viral population and the progressive accumulation of RAL resistance-associated mutations and polymorphisms associated with therapy failure.

Conclusion: The complex patterns of resistance mutations observed, including novel variants evolved under continuous RAL pressure, suggesting that they are the result of the equilibrium between drug resistance and enzyme function. Despite the efficacy of this compound, our data discourage its use in a functional monotherapy and maintaining RAL even in presence of RAL resistance-associated mutations may lead to the progressive formation of viral reservoirs with multiple integrase inhibitor-resistant variants that may limit the future efficacy of other integrase inhibitors due to cross-resistance.

Back to Top | Article Outline

Introduction

Raltegravir (RAL) is an integrase inhibitor (INI) that impairs the essential strand transfer activity of the enzyme [1]. Its novel mechanism of action makes this drug a promising agent for the treatment of human immunodeficiency virus type 1 (HIV-1) in antiretroviral-experienced patients in which resistance to other antiretroviral drugs has occurred [2–5]. In the present study, we describe seven triple class failure HIV-1 (clade B)-infected patients, followed at San Raffaele Hospital and enrolled in the RAL Expanded Access Program (MK0518-023).

Back to Top | Article Outline

Patients and methods

RAL-based antiretroviral regimens were prescribed according to viral tropism, screening genotype and all the previous resistance tests. In none of the patients, it was possible to construct a regimen based on three fully active drugs. Three patients harbored an R5 virus, thus allowing addition of maraviroc [6] (EAP A4001050) to the RAL-based regimen. The remaining four patients did not have fully active drugs other than RAL; etravirine [7] (EAP TMC 125–214) was added because of possible residual antiviral activity.

All the patients had previous experience of multiple antiretroviral regimens and multiple therapeutic failures. According to Stanford database reports and genotypic sensitivity scores, they had limited therapeutic options: the two novel drugs having the only fully active molecules in their regimens (Table 1). The patients were prospectively monitored at baseline, week 4, 12, 24, 36, 48 and 56 for clinical, virologic and immunologic parameters including HIV-1 viremia (Versant HIV-qRNA3.0 Assay; Bayer, Pittsburgh, Pennsylvania, USA), and CD4+ T-cell counts. Adherence to therapy was evaluated for each patient by using a self-reported questionnaire. Sequencing of reverse transcriptase, protease and gp41 genes was performed as described [8,9] whereas the integrase region (codons 1–280) was amplified from patient plasma RNA extracts by using a home-made protocol every 4–12 weeks. In particular, viral RNA was extracted using QIAamp viral RNA mini kit (Qiagen, Chatsworth, California, USA). The following outer primers were used in the nested PCR amplification reaction: F1 (GGGTTGGTCAGTGCTGGAAT) and R2 (AATCCTCATCCTGTCTACTTGCCACACAATC). Internal primers were IntegFw (TTTTAGATGGAATAGATAAGGCCCAAGA) and IntegRw (AAAACAGATGGCAGGTGATGATTGTGTGGC). Reverse transcription of HIV-1 RNA present in plasma was performed with random hexamers and 200 U of SuperScript III RNaseH-RT (Invitrogen, Carlsbad, California, USA) at 37°C for 60 min. An amount of cDNA equivalent to 50–1000 copies of template (as evaluated by HIV-1 RNA copies/ml) was used for PCR amplification. An Expand High Fidelity PCR system (Roche, Indianapolis, Indiana, USA) and 0.2 μmol/l of F1 and R2 primers were used for the first round. The cycling conditions were 94°C for 2 min followed by 35 cycles of 94°C for 1 s, 55°C for 30 s and 68°C for 4 min, with a final extension of 68°C for 10 min. Second-round PCR was performed by using 2 μl of the first-round PCR product and primers IntegFw and IntegRw under the same conditions used for the first round.

Table 1
Table 1
Image Tools

One sample at a time was processed, and clinical samples were amplified in triplicate. Before cloning, a 10-μl aliquot of the amplified product was run on a 10% polyacrylamide gel electrophoresis to screen for the appropriate-sized band (ca. 850 bp). Amplified products were sequenced directly (GenBank accession numbers EU908741-EU908777) or cloned into the pCR4-TOPO vector using the TOPO TA Cloning Kit (Invitrogen). After transformation, four to 10 clones for each time point were sequenced using an ABIPRISM 3131 Genetic Analyzer (Applied Biosystem, Foster City, California, USA), and phylogenetic internal control was performed as previously described [10]. In order to reduce the bias due to sequencing or polymerase errors, only mutations present in more than two distinct clones were considered.

Resistance to antiretroviral drugs was estimated according to the Stanford database report (http://hivdb.stanford.edu) and baseline viral tropism was evaluated using the Trofile-Monogram's coreceptor assay (http://www.trofileassay.com). Resistance to RAL was evaluated according to Stanford database report and published ex-vivo phenotypic data [11,12].

Back to Top | Article Outline

Results

Between two and three logs reduction of HIV-1 viral load was observed within 4 weeks in all patients but three (patient 1, 2 and 5) due to limited adherence at least in patients 1 and 2 (Fig. 1). In all patients but two (patients 2 and 7), HIV-1 viral load rebounded to initial values as soon as the resistance mutations were detected with kinetics apparently not linked to the resistance pathway. A modest increase in CD4+ T-cell counts was observed in patients 1 and 6 despite resistant variants were documented. Drug resistance-associated mutations emerged rapidly between 8 and 24 weeks of therapy in six out of the seven patients. Due to the absence of other therapeutic options, the RAL-based salvage regimen was maintained in all patients but patient 5 even after selection of RAL resistance mutations. In patient 7, viral load dropped from 917 150 copies/ml to less than 200. This low level of viremia was maintained for 20 weeks, but never went below the detection limit of the method (50 copies/ml). Interestingly, viral sequences from this patient showed at baseline, three polymorphisms in the integrase gene that were previously found associated with RAL resistance mutations (T112I, T206S and S230N), but no major resistance variants were identified later [11,12]. Three distinct patterns of RAL resistance mutations were identified in the other patients, including the G140S-Q148R/H (two patients), N155H (one patient) and the Y143C/R/H (+L74M) pattern (four patients). In patients 1, 2 and 3, the following major resistance mutations were selected: Y143R, G140S + Q148H and Y143C, respectively.

Fig. 1
Fig. 1
Image Tools
Back to Top | Article Outline
Clonal analysis

Integrase gene clonal sequence alignments (codons 1–240) of patients derived viral quasispecies are shown in Supplemental Fig. S1. In patients 1, 2, 3 and 7, clonal analysis allowed to confirm the data observed by direct sequencing showing the presence of homogeneous and stably fixed viral variants; in patients 4, 5 and 6, more complex patterns of viral evolution were documented. In patient 4, the selection of a Y143C variant at week 24 followed by a Y143C + L74M double mutant after 2 additional months of therapy was observed. In this patient, resistance to enfuvirtide also occurred due to the selection of variants with G36V and G42D mutations in the gp41 gene. A novel viral population with a novel mutation (Y143G) at position 143 was observed after 36 weeks of therapy in the quasispecies of patient 4 together with the Y143C-resistant variant. In patient 5, a N155H + V151I variant was selected at week 24; this variant was maintained until week 36, when the therapy was suspended. Notably, the virus reverted to the wild-type variant in positions 155 and 151 but maintained the acquired secondary mutations T97A and Y143S in the absence of therapy. In this patient, the variant containing the Y143S mutation (a known polymorphism) appeared at week 12 concomitantly with viremia rebound and was replaced at week 24 by the major resistant variant N155H and finally reappeared at week 36 together with the population with the N155H mutation. In this patient, moreover, at week 24, a minor viral population (two out of seven clones) was identified with the Q148R mutation (+E138K). However, this major RAL resistance-associated mutation was never detected again in the follow-up. Patient 6, at a very early point (week 8) and after a transient control of viral replication, selected the Q148R (+E138K) resistant variant followed by a major population with both Q148H and G140S mutations after 1 month. Interestingly (the patient always reporting full adherence to therapy), a novel variant emerged into the viral population between week 12 and 20 that was bearing a combination of polymorphisms (E138A, T97A S119R) and a novel mutation in position 143 (Y143K) that was already present in the baseline and week 8 samples as minority variants (one out of seven clones at baseline and two out of 13 clones at week 8). This variant persisted for only 1 month when a G140S + Q148H(+T97A ± S119R) was selected and stably fixed into the viral population. At week 48, a Y143H primary mutation and a E138A polymorphism were also acquired by the major resistant population whereas the T97A polymorphism was lost. The antiretroviral regimen of patient 6 also included maraviroc, but starting from week 12, an X4-tropic population emerged and persisted until week 48 making the virus unsusceptible to the drug (data not shown).

Back to Top | Article Outline

Discussion

In summary, HIV-1 resistance to RAL appeared initially associated with the selection of single variants in some of the patients, indicating the possibility of a thin genetic barrier of the compound. However, in four out of seven patients, resistance and viremia rebound was associated to the appearance of more than one mutation in the core domain of the protein, and in four of the seven patients, a complex pattern of viral mutations was observed. Moreover, even if minority variants may go unnoticed if present in a very low proportion at prior time points, clonal analysis documented a stepwise accumulation of RAL resistance-associated mutations in five out of the seven patients. In some cases, even if bulk amplification is prone to introducing methodological artifacts [13], recombination events and multiple quasispecies substitutions when RAL treatment was maintained after viral failure can be hypothesized.

Notably, several polymorphisms that were previously described in patients with RAL resistance [11] were already present in baseline samples (T112I, V165I, V201I, V206S, S230N); in some cases, they were also selected together with major mutations during the RAL-based therapy (T97A, S119R E138A, Y143S, V151I), suggesting a possible compensatory role of these mutations. Further analysis may also clarify if the presence of some of these polymorphisms may facilitate the appearance of major resistance mutations. In particular, we observed an association between mutations at positions 143 and 97 (Y143C/K/R/H and T97A). In position 143, the selection of three novel variants (Y143S, Y143K and Y143G) was also documented. The frequency of mutations in position 143 is of some interest considering that the 143 residue has been described as critical for the behavior of HIV-1 integrase at the preintegration steps [14]. Even if phenotypic analysis is clearly necessary to confirm a role of these mutations, it is noteworthy that they appeared in two patients during viremia rebound. In both cases, these mutations were subsequently replaced by major resistance mutations, such as Q148H ± Y143H and N155H.

The dynamic mutation patterns observed during RAL treatment could represent the molecular counterpart of the equilibrium between drug resistance and enzyme function necessary for virus replication. In this context, early RAL discontinuation may stop the increase of drug resistance mutation and the recovery of viral fitness. From a therapeutic viewpoint, the data support the hypothesis of a relatively low genetic barrier of RAL and, despite the potency of this compound, strongly discourage its use in a functional monotherapy in salvage regimens. This compound should be administered together with the highest number of active drugs. The decision to maintain RAL even in the presence of RAL resistance-associated mutations, due to absence of other therapeutic options, may lead to the progressive selection of multiple INI-resistant variants within the patients and to the formation of viral reservoirs that may limit the future efficacy of other INIs due to multiple cross-resistant archived genomes [12,15].

Back to Top | Article Outline

Acknowledgements

F.C. conceived and designed the experiments, analyzed the data and wrote the article. M.S., M.C.M., A.G. performed the experiments. E.B. analyzed the data. V.S. clinically followed up patients. A.C. and N.G. clinically followed up patients, analyzed the data and wrote the article. A.L. and M.C. analyzed the data and wrote the article.

Back to Top | Article Outline

References

1. Croxtall JD, Lyseng-Williamson KA, Perry CM. Raltegravir. Drugs 2008; 68:131–138.

2. Cooper DA, Steigbigel RT, Gatell JM, Rockstroh JK, Katlama C, Yeni P, et al. Subgroup and resistance analyses of raltegravir for resistant HIV-1 infection. N Engl J Med 2008; 359:355–365.

3. Steigbigel RT, Cooper DA, Kumar PN, Eron JE, Schechter M, Markowitz M, et al. Raltegravir with optimized background therapy for resistant HIV-1 infection. N Engl J Med 2008; 359:339–354.

4. Grinsztejn B, Nguyen BY, Katlama C, Gatell JM, Lazzarin A, Vittecoq D, et al. Safety and efficacy of the HIV-1 integrase inhibitor raltegravir (MK-0518) in treatment-experienced patients with multidrug-resistant virus: a phase II randomised controlled trial. Lancet 2007; 369:1261–1269.

5. Moyle G, Gatell J, Perno CF, Ratanasuwan W, Schechter M, Tsoukas C. Potential for new antiretrovirals to address unmet needs in the management of HIV-1 infection. AIDS Patient Care STDS 2008; 22:459–471.

6. MacArthur RD, Novak RM. Reviews of antiinfective agents: maraviroc – the first of a new class of antiretroviral agents. Clin Infect Dis 2008; 47:236–241.

7. Geretti AM. Shifting paradigms: the resistance profile of etravirine. J Antimicrob Chemother 2008; 62:643–647.

8. Menzo S, Castagna A, Monachetti A, Hasson H, Danise A, Carini E, et al. Genotype and phenotype patterns of human immunodeficiency virus type 1 resistance to enfuvirtide during long-term treatment. Antimicrob Agents Chemother 2004; 48:3253–3259.

9. Boeri E, Gianotti N, Canducci F, Hasson H, Giudici B, Castagna A, et al. Evolutionary characteristics of HIV type 1 variants resistant to protease inhibitors in the absence of drug-selective pressure. AIDS Res Hum Retroviruses 2003; 19:1151–1153.

10. Boeri E, Canducci F, Grasso MA, Presi S, Carrera P, Racca S, et al. Phylogenetic internal control for HIV-1 genotypic antiretroviral testing. New Microbiol 2004; 27:105–109.

11. Malet I, Delelis O, Valantin MA, Montes B, Soulie C, Wirden M, et al. Mutations associated with failure of raltegravir treatment affect integrase sensitivity to the inhibitor in vitro. Antimicrob Agents Chemother 2008; 52:1351–1358.

12. Lataillade M, Chiarella J, Kozal MJ. Natural polymorphism of the HIV-1 integrase gene and mutations associated with integrase inhibitor resistance. Antivir Ther 2007; 12:563–570.

13. Salazar-Gonzalez JF, Bailes E, Pham KT, Salazar MG, Guffey MB, Keele BF, et al. Deciphering human immunodeficiency virus type 1 transmission and early envelope diversification by single-genome amplification and sequencing. J Virol 2008; 82:3952–3970.

14. Tsurutani N, Kubo M, Maeda Y, Ohashi T, Yamamoto N, Kannagi M, et al. Identification of critical amino acid residues in human immunodeficiency virus type 1 IN required for efficient proviral DNA formation at steps prior to integration in dividing and nondividing cells. J Virol 2000; 74:4795–4806.

15. Hombrouck A, Voet A, Van Remoortel B, Desadeleer C, De Maeyer M, Debyser Z, et al. Mutations in human immunodeficiency virus type 1 integrase confer resistance to the naphthyridine L-870,810 and cross-resistance to the clinical trial drug GS-9137. Antimicrob Agents Chemother 2008; 52:2069–2078.

Fig. 1
Fig. 1
Image Tools

Cited By:

This article has been cited 15 time(s).

Current Opinion in Virology
Drug resistance in HIV-1
Kuritzkes, DR
Current Opinion in Virology, 1(6): 582-589.
10.1016/j.coviro.2011.10.020
CrossRef
Hiv Medicine
Longitudinal analysis of integrase N155H variants in heavily treated patients failing raltegravir-based regimens
Nguyen, HL; Charpentier, C; Nguyen, N; de Truchis, P; Molina, JM; Ruxrungtham, K; Delaugerre, C
Hiv Medicine, 14(2): 85-91.
10.1111/j.1468-1293.2012.01039.x
CrossRef
Antimicrobial Agents and Chemotherapy
Impact of Primary Elvitegravir Resistance-Associated Mutations in HIV-1 Integrase on Drug Susceptibility and Viral Replication Fitness
Abram, ME; Hluhanich, RM; Goodman, DD; Andreatta, KN; Margot, NA; Ye, LD; Niedziela-Majka, A; Barnes, TL; Novikov, N; Chen, XW; Svarovskaia, ES; McColl, DJ; White, KL; Miller, MD
Antimicrobial Agents and Chemotherapy, 57(6): 2654-2663.
10.1128/AAC.02568-12
CrossRef
Antiviral Research
Molecular basis of human immunodeficiency virus drug resistance: An update
Menendez-Arias, L
Antiviral Research, 85(1): 210-231.
10.1016/j.antiviral.2009.07.006
CrossRef
Journal of Antimicrobial Chemotherapy
Raltegravir has no residual antiviral activity in vivo against HIV-1 with resistance-associated mutations to this drug
Wirden, M; Simon, A; Schneider, L; Tubiana, R; Malet, I; Ait-Mohand, H; Peytavin, G; Katlama, C; Calvez, V; Marcelin, AG
Journal of Antimicrobial Chemotherapy, 64(5): 1087-1090.
10.1093/jac/dkp310
CrossRef
Plos One
The HIV-1 Integrase Mutations Y143C/R Are an Alternative Pathway for Resistance to Raltegravir and Impact the Enzyme Functions
Reigadas, S; Anies, G; Masquelier, B; Calmels, C; Stuyver, LJ; Parissi, V; Fleury, H; Andreola, ML
Plos One, 5(4): -.
ARTN e10311
CrossRef
Journal of Antimicrobial Chemotherapy
Genotypic/phenotypic patterns of HIV-1 integrase resistance to raltegravir
Canducci, F; Marinozzi, MC; Sampaolo, M; Boeri, E; Spagnuolo, V; Gianotti, N; Castagna, A; Paolucci, S; Baldanti, F; Lazzarin, A; Clementi, M
Journal of Antimicrobial Chemotherapy, 65(3): 425-433.
10.1093/jac/dkp477
CrossRef
Drugs
Raltegravir In Treatment-Naive Patients with HIV-1 Infection
Croxtall, JD; Scott, LJ
Drugs, 70(5): 631-642.

Current Opinion in Virology
The development of novel HIV integrase inhibitors and the problem of drug resistance
Wainberg, MA; Mesplede, T; Quashie, PK
Current Opinion in Virology, 2(5): 656-662.
10.1016/j.coviro.2012.08.007
CrossRef
AIDS Research and Human Retroviruses
Short Communication Analysis of the Integrase Gene from HIV Type 1-Positive Patients Living in a Rural Area of West Cameroon
Turriziani, O; Montagna, C; Falasca, F; Bucci, M; Russo, G; Lichtner, M; Sobze, MS; Vullo, V; Pistello, M; Antonelli, G
AIDS Research and Human Retroviruses, 28(): 1729-1733.
10.1089/aid.2011.0266
CrossRef
Hiv Clinical Trials
Prevalence of Primary Resistance Mutations to Integrase Inhibitors in Treatment-Naive and -Experienced Patients Infected With B and Non-B HIV-1 Variants
Gutierrez, C; Hernandez-Novoa, B; Perez-Elias, MJ; Moreno, AM; Holguin, A; Dronda, F; Casado, JL; Moreno, S
Hiv Clinical Trials, 14(1): 10-16.
10.1410/hct1401-10
CrossRef
Journal of Virology
Comprehensive In Vitro Analysis of Simian Retrovirus Type 4 Susceptibility to Antiretroviral Agents
Togami, H; Shimura, K; Okamoto, M; Yoshikawa, R; Miyazawa, T; Matsuoka, M
Journal of Virology, 87(8): 4322-4329.
10.1128/JVI.03208-12
CrossRef
Bioorganic & Medicinal Chemistry
Inhibition of HIV-1 integrase dimerization and activity with crosslinked interfacial peptides
Zhao, L; Chmielewski, J
Bioorganic & Medicinal Chemistry, 21(): 4041-4044.
10.1016/j.bmc.2012.10.032
CrossRef
Bmc Infectious Diseases
HIV-1 integrase resistance among antiretroviral treatment naive and experienced patients from Northwestern Poland
Parczewski, M; Bander, D; Urbanska, A; Boron-Kaczmarska, A
Bmc Infectious Diseases, 12(): -.
ARTN 368
CrossRef
AIDS
The dynamics of appearance and disappearance of HIV-1 integrase mutations during and after withdrawal of raltegravir therapy
Ferns, RB; Kirk, S; Bennett, J; Williams, I; Edwards, S; Pillay, D
AIDS, 23(16): 2159-2164.
10.1097/QAD.0b013e32832ec4ae
PDF (387) | CrossRef
Back to Top | Article Outline
Keywords:

HIV-1; integrase; raltegravir; resistance

© 2009 Lippincott Williams & Wilkins, Inc.

Login

Search for Similar Articles
You may search for similar articles that contain these same keywords or you may modify the keyword list to augment your search.