Skip Navigation LinksHome > November 30, 2008 - Volume 22 - Issue 18 > HIV-specific regulatory T cells are associated with higher C...
AIDS:
doi: 10.1097/QAD.0b013e328319edc0
Basic Science

HIV-specific regulatory T cells are associated with higher CD4 cell counts in primary infection

Kared, Hassena; Lelièvre, Jean-Daniela,b,c; Donkova-Petrini, Vladimiraa; Aouba, Albertined; Melica, Giovannab,c; Balbo, Michèlea; Weiss, Laurencea,d,e; Lévy, Yvesa,b,c

Free Access
Article Outline
Collapse Box

Author Information

aINSERM, Unite U841, France

bUniversite Paris 12, Faculte de Medecine, France

cAP-HP, Groupe Henri-Mondor Albert-Chenevier, Immunologie clinique, Creteil, France

dAP-HP, Hôpital Européen Georges Pompidou, Immunologie clinique, France

eUniversité Paris Descartes, Faculté de Médecine, Paris, France.

Received 7 September, 2008

Accepted 8 September, 2008

Correspondence to Professor Y. Lévy, Service d'Immunologie Clinique, Hôpital Henri Mondor and INSERM U841 and University Paris 12, Créteil, France. Tel: +33 1 49 81 24 55; fax: +33 1 49 81 24 69; e-mail: yves.levy@hmn.aphp.fr

Collapse Box

Abstract

Objective: Expansion of regulatory T (Treg) cells has been described in chronically HIV-infected individuals. We investigated whether HIV-suppressive Treg could be detected during primary HIV infection (PHI).

Methods: Seventeen patients diagnosed early after PHI (median: 13 days; 1–55) were studied. Median CD4 cell count was 480 cells/μl (33–1306) and plasma HIV RNA levels ranged between 3.3 and 5.7 log10 copies/ml. Suppressive capacity of blood purified CD4+CD25+ was evaluated in a coculture assay. Fox-p3, IL-2 and IL-10 were quantified by reverse transciptase (RT)-PCR and intracellular staining of ex vivo and activated CD4+CD25high T cells.

Results: The frequency of CD4+CD127lowCD25high T cells among CD4 T cells was lower in patients with PHI compared with chronic patients (n = 19). They exhibited a phenotype of memory T cells and expressed constitutively FoxP3. Similar to chronic patients, Treg from patients with PHI inhibited the proliferation of purified tuberculin (PPD) and HIV p24 activated CD4+CD25 T cells. CD4+CD25high T cells from patients with PHI responded specifically to p24 stimulation by expressing IL-10. In untreated patients with PHI, the frequency as well as HIV-specific activity of Treg decreased during a 24-month follow-up. A positive correlation between percentages of Treg and both CD4 cell counts and the magnitude of p24-specific suppressive activity at diagnosis of PHI was found.

Conclusion: Our data showed that HIV drives Treg, as PHI and these cells persist throughout the course of the infection. A correlation between the frequency of Treg and CD4 T-cell counts suggest that these cells may impact on the immune activation set point at PHI diagnosis.

Back to Top | Article Outline

Introduction

Primary HIV infection (PHI) is characterized by high levels of viral replication followed by induction of HIV-specific CD4 and CD8 T-cell immune responses [1–4]. Studies have shown that the magnitude of those immune responses determines the subsequent course of infection [5–7]. However, these responses are ineffective at eradicating the virus, and the chronic infection characterized by a gradual loss of CD4 T cells leads to AIDS without therapy in the majority of patients.

A relationship between T-cell activation, CD4 T cell decline and clinical outcome has been shown in the chronic phase of the infection [8–11]. Several clinical studies [12,13] have also demonstrated that the virological and immunological events that occur during PHI are strongly predictive of disease progression. These reports support the hypothesis that HIV causes CD4 T-cell depletion as a consequence of generalized T-cell activation [14,15]. This was confirmed in a prospective study [16] conducted in acutely infected adults showing that ‘the immune activation set point’ established early in HIV infection determines the rate of CD4 T cell loss over time.

Regulatory T cells (Treg) finely regulate immune responses and cellular activation [17]. Treg cells including CD4+CD25high Foxp3+ T cells were reported to influence the outcome of various infections [18]. CD4+CD25+ Treg cells suppress antigen-specific CD4 and CD8 responses and also control inappropriate or exaggerated immune activation induced by pathogens [19,20]. We, and others, have reported that regulatory CD4+CD25+ T cells can suppress HIV-specific effector CD4 and CD8 T-cell responses in chronically HIV-infected patients [21,22]. We have found in chronically infected patients that HIV antigens triggered the proliferation of virus-specific Treg [23]. However, the influence of Treg in HIV infection remains unclear [24]. Treg can limit immune activation and viral replication but may dampen polyfunctional adaptive immune responses against viral antigens [23,25–28].

In the present study we investigated whether Treg cells could be detected in early phases of HIV infection. For this, a comparison of Treg frequency, phenotype and function in patients studied at early and chronic stages of HIV infection was undertaken. The effects of in-vitro stimulation with HIV antigen of purified Treg from patients diagnosed with PHI were studied. From a clinical standpoint, we looked at the correlation between Treg frequency and CD4 T-cell counts and plasma HIV RNA values at PHI. The impact of combined antiretroviral therapy initiation during PHI on Treg function was studied in a 24-month longitudinal follow-up of patients.

Back to Top | Article Outline

Patients and methods

This is a prospective study conducted in two clinical sites in France. To be enrolled, individuals must have had evidence of acute or recent HIV infection as defined by a negative or weakly reactive HIV antibody enzyme immunoassay with less than three bands on HIV Western Blot and detectable plasma HIV RNA. Individuals were offered to participate in this study before physician's decision of combination antiretroviral therapy (c-ART) initiation on the basis of usual criteria and physician's judgment. Chronic HIV-infected patients included in this study had received c-ART for at least 1 year and exhibited CD4 cell counts above 500 cells/mm3 and plasma HIV viral load below 50 copies/ml. Fresh blood samples were collected on ethylenediaminetetraacetic acid (EDTA) tubes and processed within 3 h after they were drawn. All patients provided written informed consent; the study was approved by the ethical committee of Hôpital Européen Georges Pompidou, Paris, France.

Back to Top | Article Outline
Cell isolation

CD4 T lymphocytes were purified from whole blood using RosetteSep CD4 enrichment and CD8 depletion antibody cocktail (Stem Cell Technologies, Vancouver British Columbia, Canada). CD4 T cells (>90% purity) were incubated with CD25 magnetic beads (Miltenyi Biotech, Baltimore, Maryland, USA) allowing the purification of CD4+CD25+ (20 μl per 107 cells) or CD4+CD25high populations (2 μl per 107 cells). The CD4+CD25+ or CD4+CD25high cells were subsequently separated using two passages on magnetic columns. This generally resulted in obtaining higher than 85% purity of cell populations. Monocytes (>90% purity) obtained by plastic adherence were used as antigen-presenting cells.

Back to Top | Article Outline
Flow cytometric analysis

Phenotyping of the CD4+CD25+ and CD4+CD25 cell subsets was performed on fresh whole blood samples using four-colour direct flow cytometry. Monoclonal antibodies (mAbs) conjugated to fluorescein isothiocyanate (FITC), phycoerythrin, peridinin chlorophyl protein (PerCP) or allophycocyanin (APC) were used for immunostaining (All purchased by BD Biosciences; Le Pont Claix, France): anti-CD25-FITC, anti-CD4-PerCP, anti-CD3-APC, anti-CD45RO-APC, anti-CD25-APC, anti-CD25-PE, anti-HLA-DR-PE, anti-CD45RA-PE, anti-CD127-PE, anti-CD40L-PE, anti-CD122-PE, anti-CD95-PE, anti-CD69-PE, anti-CD103-PE and anti-CTLA-4-PE as previously described [23]. For staining of Foxp3, the cells were fixed and permeabilized using a fixation or permeabilization kit according to the manufacturer's protocol. Lymphocytes were stained with Alexafluor 488 antihuman Foxp3 (PCH101, eBioscience, San Diego, California, USA). Isotype-matched controls were used in all staining experiments. The production of IL-10 and IL-2 by anti-CD3/anti-CD28 or p24 activated CD4+CD25- and CD4+CD25high purified cells was assessed as previously described [23].

Analyses were performed using FACScalibur and CellQuest software (Becton Dickinson, San Jose, California, USA) on at least 10 000 events. Gating was restricted to the population of lymphocytes according to their light scattering properties.

Back to Top | Article Outline
Proliferation and suppression assays

The different subpopulations (CD4+CD25 cells and CD4+CD25+ cells) were assessed for their proliferative capacities in response to polyclonal stimulation and to recall antigens and p24 protein as previously described [23]. Antigen tested were: 5 μg/ml purified tuberculin (Tuberculin, Statens Seruminstitut, Copenhagen, Denmark), 5 μg/ml p24 protein (Protein Science Corp, Meriden, Connecticut, USA) or 5 μg/ml of cytomegalovirus (CMV) antigen (BioWhittaker Europe, Verviers, Belgium), in combination with soluble anti-CD28 mAb. For direct suppression assays, CD4+CD25 lymphocytes were incubated for 5 days in the presence of p24 or Tuberculin either alone or with varying numbers of CD4+CD25+ cells resulting in a suppressor: responder ratios of 0/1, 1/1, 1/2 and 1/10 in a final amount of 5 × 104 cells/well. Percentage of inhibition was calculated as follows: 1 − [mean count per minute (cpm) of coculture wells divided by mean cpm of CD4+CD25 cells cultured alone] × 100. Cell proliferation was assessed using 0.5 μCi [3H] thymidine (Amersham Pharmacia, Uppsala, Sweden) incorporation. Stimulation indices were calculated by dividing the mean cpm of stimulated cells by the mean cpm of unstimulated cells.

Back to Top | Article Outline
RNA isolation and real time quantitative reverse transcriptase-PCR

Total RNA from 5 × 104 purified CD4+CD25 and CD4+CD25high cells either nonstimulated or after 48 h stimulation in the presence of plate-bound anti-CD3 and soluble anti-CD28 or p24 antigen was purified as previously described [23]. Quantitative PCR was performed in a LightCycler System (Roche diagnostics, Meylan, France) using a SYBR Green PCR kit from Roche Diagnostics. The cDNA input for each population was normalized to obtain equivalent signals with Splicing Factor 3A1 (SF3A1) used as housekeeping gene. Primers used were:

SF3A1; Forward: TGCAGGATAAGACGGAATGGAAACTGA,

Reverse: GTAGTAAGCCAGTGAGTTGGAATCTTTG

Foxp3; Forward: TCCACAACATGCGACCCCCTTTCA

Reverse: ACAGCCCCCTTCTCGCTCTCCA

IL-2; Forward: TGCTGGATTTACAGATGATTTTG

Reverse: TGAGCATCCTGGTGAGTTTG

IL-10; Forward: AGTCTGAGAACAGCTGCACCCACTTC

Reverse: GGGCATCACCTCCTCCAGGTAA

Back to Top | Article Outline
Statistical analysis

Data are expressed as mean ± SD for percentages and median and ranges for absolute values. Statistical comparisons were performed using Mann–Whitney rank sum test. Analysis of correlation was assessed using the Spearman rank test for nonparametric data. All results were conducted using Prism Graphpad Ver5 (Graphpad Software, San Deigo, California, USA). Significance was considered for value of P ≤ 0.05.

Back to Top | Article Outline

Results

Phenotypic characteristic of circulating CD4+CD25high T cells in patients with primary HIV infection

Seventeen patients diagnosed early after PHI (median: 13 days; 1–55 days) were studied. Median CD4 cell count was 480 cells/μl (33–1306) and plasma HIV RNA levels ranged from 3.3 to 5.7 log10 copies/ml. As the level of immune activation in nontreated patients with PHI may hamper discrimination between Treg and activated CD4 T cells that may also express CD25 and FoxP3 molecules, we evaluated the percentage of cells expressing high levels of CD25. These cells exhibit lower levels of CD127 molecules and higher FoxP3 expression as compared with CD4+CD25 and CD4+CD25low T cells as shown in Fig. 1(a) and (b) for a representative PHI patient. Analysis of the cohort of PHI and c-ART treated chronic patients (n = 19) showed that the median percentages of CD4+CD25high T cells were 2.2 and 5.3% in PHI and chronic patients, respectively (P < 0.05) (Fig. 1c).

Fig. 1
Fig. 1
Image Tools

We investigated whether these CD4+CD25high T cells might exhibit other phenotypic features of Treg previously characterized in chronic HIV-infected patients [23]. As shown in Fig. 1d, analysis of CD4+CD25high from 13 patients with PHI showed that these cells express the characteristics of Treg. As compared with CD4+CD25, CD4+CD25high exhibit a phenotype of memory T cells as 65% (median) express CD45RO molecule (P < 0.05) with around 21% coexpressing the CD45RA marker. Forty five percent of CD4+CD25high express CD122, the β chain of the IL-2 receptor, as compared with 2% of CD4+CD25 (P < 0.001). Fifty and 25% of CD4+CD25high express HLA-DR and CD40L as compared with 5% (P < 0.01) and less than 1% (P < 0.001) of CD4+CD25, respectively. Finally, a higher proportion of CD4+CD25high compared with CD4+CD25 T cells express antigens such as CD69 (20%) (P < 0.001), CD103 (17%) (P < 0.001) and iCTLA-4 (18%) (P < 0.05). We next confirmed that purified CD4+CD25high T cells isolated from patients with PHI express high levels of FoxP3 (Fig. 1b). Globally, these results show that CD4+CD25high express phenotypic features of Treg. Moreover, they did not differ significantly from Treg characterized in chronic HIV patients [23].

Back to Top | Article Outline
Peripheral CD4+CD25+ T cells from primary HIV infection patients are hyporesponsive to polyclonal and antigen-specific stimulation

In order to determine whether CD4+CD25+ circulating T cells in PHI patients exhibit functional characteristics of Treg, we assessed their ability to proliferate in response to recall antigens including Tuberculin, CMV and p24 protein. As functional experiments required a higher number of cells, we performed these assays using CD4+CD25+ that contained a high proportion of CD4+CD25high T cells (ranging from 75 to 85%) (not shown), as previously reported [23]. In the presence of anti-CD3 and soluble anti-CD28 mAbs, CD4+CD25− and CD4+CD25+ displayed the same proliferative capacity (Fig. 2a). Similar to CD4+CD25+ isolated from chronic patients, CD4+CD25+ from patients with PHI did not proliferate in the presence of tuberculin, CMV, or p24 antigens (Fig. 2a) as compared with CD4+CD25 cells from PHI and chronic patients (Fig. 2a). These results demonstrate that CD4+CD25+ isolated in patients with PHI exhibit in-vitro proliferative characteristics of regulatory T cells.

Fig. 2
Fig. 2
Image Tools
Back to Top | Article Outline
Peripheral CD4+CD25+ from patients with primary HIV infection suppress CD4 T-cell proliferation in response to recall antigens and HIV proteins

We investigated the potential suppressive effect of CD4+CD25+ isolated from PHI and chronic patients. As shown in Fig. 2b, addition of increasing numbers of CD4+CD25+ T cells resulted in a similar dose-dependent inhibition of the proliferation of CD4+CD25 to tuberculin and p24 protein in PHI (n = 9) and chronic patients (n = 6). At a ratio CD4+CD25+/CD4+CD25 of 1/4, CD4+CD25+ from PHI and chronic patients inhibited by 37 and 46% in median autologous CD4+CD25 proliferation to tuberculin, respectively. At the same ratio, the response to p24 antigens was inhibited by 50 and 52% by CD4+CD25+ purified from PHI and chronic patients, respectively (Fig. 2b). This suppressive effect was up to 75% when cells were mixed at a 1/1 ratio.

Back to Top | Article Outline
Analysis of cytokine expression by CD4+CD25high T cells from patients with primary HIV infection in response to HIV antigens

We have previously demonstrated that Treg isolated from chronic patients treated with c-ART exhibited a specific bias towards HIV antigens by producing either IL-10 or expressing TGF-β transcripts [23]. Therefore, we were interested to investigate whether such cells could be detected among patients with PHI. We have focused our analysis on purified CD4+CD25high T cells from six patients at early time after diagnosis.

Following polyclonal stimulation, the mean frequency of CD4+CD25high and CD4+CD25 T cells producing IL-2 increases significantly from 2.3 ± 0.65% and 0.6 ± 0.06% to 15.5 ± 4.1% and 7.8 ± 1%, respectively (Fig. 3a). In the same conditions, mean percentages of CD4+CD25high and CD4+CD25 producing IL-10 increased from 3.4 ± 0.6% and 1.9 ± 0.4% to 22.3 ± 5.8% (P < 0.05) and 6.2 ± 1.2% (P < 0.05), respectively. HIV-specific stimulation induces a greater percentage of CD4+CD25high IL-2+cells (14.7 ± 4.4%) than CD4+CD25IL-2+cells (0.9 ± 0.1%) (P < 0.001). Similarly, in the same stimulation conditions, the frequency of CD4+CD25highIL-10+ cells was higher (16.2 ± 3.5%) than CD4+CD25IL-10+ (1.1 ± 0.16%) (P < 0.01). Altogether, these results indicate the presence of p24 specific T cells producing IL-2 and IL-10 among CD4+CD25high cells isolated from patients with PHI.

Fig. 3
Fig. 3
Image Tools

Next, we investigated the level of mRNA transcripts of Foxp3, IL-2 and IL-10 at baseline and after stimulation in CD4+CD25high and CD4+CD25 T cells. Samples from five patients with PHI and three chronic patients were studied. As shown in Fig. 3b, CD4+CD25high cells express higher levels of FoxP3 transcripts that remained stable following polyclonal and p24 stimulation. HIV-specific stimulation induced a significant increase of IL-10 mRNA levels in CD4+CD25high (P < 0.05), but not in the CD4+CD25 subsets.

Back to Top | Article Outline
Longitudinal follow-up of the suppressive capacity of CD4+CD25+ isolated from patients with primary HIV infection

Next, we followed longitudinally up to 24 months the suppressive capacity of Treg isolated from six patients with PHI who did not initiate c-ART on the basis of clinical, immunological and physician's decisions. Follow-up showed that percentages of CD4+CD25high dropped from 4.27 ± 0.76% at diagnosis to 1.82 ± 0.52% at months 6 (not shown) and 24 (Fig. 4a). We analysed the suppressive activity of CD4+CD25+ T cells from these patients with PHI throughout the follow-up. CD4+CD25+ isolated at times of PHI diagnosis (month 0), and at months 6 and 24 were mixed at a 1/4 ratio to autologous CD4+CD25 T cells in the presence of either tuberculin or p24 antigens. Interestingly, the suppression of CD4+CD25 proliferation in response to tuberculin by CD4+CD25+ did not vary over time and ranged from 29 ± 2.3% at diagnosis (month 0) to 47% ± 11.2% at month 24 (P = NS). In contrast, suppressive activity of CD4+CD25+ in response to p24 decreased from 59 ± 8.2% at diagnosis to 27.4 ± 5.8% at month 6 (P < 0.05) and remained stable thereafter (23 ± 10% at month 24) (Fig. 4b).

Fig. 4
Fig. 4
Image Tools
Back to Top | Article Outline
Correlation between frequency of CD4+CD25high and CD4 T-cell counts at diagnosis of primary HIV infection

In our prospective cohort of PHI patients, nine of them initiated c-ART following the diagnosis of HIV infection on the basis of clinical and immunological considerations. Median of CD4 T-cell counts of patients who initiated c-ART was significantly lower than that of patients who remained untreated during the follow-up (352 cells/μl and 561 cells/μl, respectively; P < 0.05), whereas plasma HIV RNA did not differ significantly (5–5.3 log10 copies/ml). Moreover, the long-term follow-up of untreated patients with PHI up to 24 months showed that they did not develop any AIDS-defining events nor indication to start c-ART according to the current guidelines. This led us to investigate whether the frequency and the suppressive capacity of Treg at PHI diagnosis could be correlated to the level of CD4 T-cell counts, plasma viral load or CD4 T-cells activation. We found a correlation between the percentage of CD4+CD25high cells and CD4 T-cell counts, but not plasma viral load, at the diagnosis of PHI (r = 0.6; P < 0.01) (Fig. 5a). Interestingly, we found a negative association between the frequency of Treg and of HLA-DR expressing CD4 T cells (r = −0.66; P = 0.01) (Fig. 5b). Moreover, a correlation between the frequency of CD4+CD25high at diagnosis and the percentage of inhibition of CD4+CD25 proliferation in the presence of p24, but not tuberculin, was found (r = 0.8, P < 0.05) (Fig. 5c). These results show that a higher frequency of Treg inhibiting HIV-specific immune responses is associated with a higher CD4 T-cells count in patients with PHI at diagnosis.

Fig. 5
Fig. 5
Image Tools
Back to Top | Article Outline

Discussion

The purpose of this study was to determine whether HIV-specific Treg are present at early stages of HIV infection and to characterize their suppressive activity in regard to CD4 HIV-specific activity. We present data supporting the induction of HIV-specific Treg mediated suppression of HIV-specific CD4 T cells in patients with PHI. Treg exhibiting a CD4+CD25highCD127low phenotype and expressing high levels of the transcription factor FoxP3 are detectable in the blood at early stages of HIV infection. These cells displayed suppressive activity by inhibiting the proliferation of CD4+CD25 stimulated with HIV or recall antigens and secreted IL-10. Interestingly, in-vitro stimulation of Treg from patients with PHI with HIV antigens led to an increase of IL-10 synthesis demonstrating the presence of a proportion of HIV-specific T cells in Treg. Altogether, these data extended those previously reported in chronic patients [23] demonstrating that HIV drives an expansion of Treg since the PHI stage.

Human CD4+CD25+ T cells have been shown to be a heterogeneous population that includes suppressive Treg cells, anergic but not suppressive T cells and normal activated T cells [29]. Interestingly, all these populations were detectable in patients with PHI studied here. Although no specific markers have been described for characterization of human Treg, the expression of high levels of CD25 and low density of CD127 molecules has been correlated with immunosuppressive Treg activity in humans [30]. Using this combination of markers and high expression of FoxP3 we attempted to quantify Treg in patients with PHI. Although FoxP3 is now widely used for the characterization of human Treg cells in healthy individuals [31], contrasting findings have been reported on the kinetics and functional effects of transient FoxP3 expression in activated human CD4+CD25 T cells [29,32–34]. These cells did not exert suppression on CD4 T-cell proliferation, a characteristic that was limited to CD4+CD25highCD127low T cells expressing higher levels of FoxP3. Thus, our results demonstrate that a true population of Treg may be identified at the early stages of PHI.

The most effective method for assessing suppressive activity of Treg is to determine their capacity to suppress the proliferation of stimulated CD4+CD25 T cells. We show that Treg from patients with PHI suppress HIV specific and nonspecific proliferation of CD4 T cells. Interestingly, we found that the percentages of Treg in patients with PHI were significantly lower than that observed in chronic patients. However, it is possible that peripheral blood may not be the most appropriate compartment to accurately assess HIV-specific Treg cell activity, particularly at the time of primary infection. Several studies in chronically HIV-infected patients and nonhuman primate models of Simian immunodeficiency virus (SIV) infection have shown a lower expression of FoxP3 and suppressor potential of Treg in the periphery compared with lymphoid tissue [25,27,28,35–37], the primary site of virus replication [38].

We found a decrease in frequency of HIV, but not tuberculin, suppressive activity of Treg throughout a 24-month follow-up of patients with PHI who remained untreated. This also suggests a preferential homing of these cells to secondary lymphoid. Moreover, as Treg need to be activated through their T-cell receptor (TCR) for exhibiting a suppressive activity [39], these data reinforce the demonstration of the presence of HIV-specific Treg in patients with PHI. Alternatively, a decrease of HIV-suppressive activity could result from chronic immune activation or from a deleterious interaction of Treg with viral protein [40,41] and antigen presenting cells [42]. Finally, although a recent report has shown that these cells are not preferentially infected by HIV [41], one hypothesis could be that Treg are infected and depleted in nontreated PHI patients.

Persistent antigens such as HIV are believed to promote the expansion and activation of antigen-specific Treg. In addition, we may speculate that, as recently reported, antigen presentation of HIV antigens by dendritic cells with tolerogenic properties and upregulation of inhibitory molecules might also participate in expansion of Treg in the context of PHI [43]. The high levels of viral replication and immune activation during PHI increase interactions between HIV or envelope proteins and CD4 or HIV coreceptors, and may favour the peripheral conversion of memory activated CD4 T cells into Treg [44]. This is likely suggested by the persistent capacity of Treg from patients with PHI to produce IL-2. However, the major characteristic of Treg populations in patients with PHI was to contain a high proportion of cells producing IL-10. The level of IL-10 transcripts and the frequency of those cells increased significantly following in-vitro stimulation with p24 antigens.

The definitive role of HIV-suppressive Treg in HIV infection is difficult to assess. On the one hand, Treg may have potentially beneficial effects by limiting the infection and deletion of HIV-specific effectors. On the other hand, our study provides new data showing that HIV-specific Treg expanded early after PHI may hamper the establishment of HIV-specific CD4 T cells responses. HIV infection in the humanized rag2−/− γC −/− mouse model supports this evidence showing that depletion of Treg before HIV infection decreases viral load [45]. We found a correlation between the percentages of Treg and higher CD4 cell counts, but not plasma viral loads, at diagnosis of PHI. Although longitudinal studies are needed to confirm the predictive role of Treg in PHI, our data support a beneficial effect of Treg during the acute phase of the infection. This observation is corroborated by recent studies showing a similar effect of Treg in nonpathogenic SIV models of acute infection [46] or more recently, in a mice model of acute mucosal HSV infection [47].

Altogether previous studies in HIV chronic infection and data on patients with PHI reported here help to figure out a global picture of Treg in HIV infection. HIV-specific Treg may control potentially pathogenic immune activation during the early phases of infection by limiting excessive activation and depletion of HIV-specific CD4 T cells. In contrast with other microbial infection, HIV is a persistent antigen that might trigger continuously long-life HIV-specific memory Treg cells resulting in an immune tolerance to HIV in vivo.

Back to Top | Article Outline

Acknowledgements

The authors thank all participating patients. We also gratefully acknowledge Corinne Jung for technical support. This project is supported by grants from the Agence Nationale de la Recherche sur le SIDA et les hépatites (ANRS), Sidaction and INSERM.

The authors have no conflicting financial interest.

Authors contribution: H. K. and V.D-P performed the experiments and analysed the data. JD. L. analysed the data and wrote the paper. M. B. performed the experiments. A. A. and G. M. recruited the patients and collected clinical data. L.W. designed the study and analysed the data. Y. L. designed the study, analysed the data and wrote the paper.

Back to Top | Article Outline

References

1. Borrow P, Lewicki H, Hahn BH, Shaw GM, Oldstone MB. Virus-specific CD8+ cytotoxic T-lymphocyte activity associated with control of viremia in primary human immunodeficiency virus type 1 infection. J Virol 1994; 68:6103–6110.

2. Kahn JO, Walker BD. Acute human immunodeficiency virus type 1 infection. N Engl J Med 1998; 339:33–39.

3. Koup RA, Safrit JT, Cao Y, Andrews CA, McLeod G, Borkowsky W, et al. Temporal association of cellular immune responses with the initial control of viremia in primary human immunodeficiency virus type 1 syndrome. J Virol 1994; 68:4650–4655.

4. Pantaleo G, Demarest JF, Soudeyns H, Graziosi C, Denis F, Adelsberger JW, et al. Major expansion of CD8+ T cells with a predominant V beta usage during the primary immune response to HIV. Nature 1994; 370:463–467.

5. Clark SJ, Saag MS, Decker WD, Campbell-Hill S, Roberson JL, Veldkamp PJ, et al. High titers of cytopathic virus in plasma of patients with symptomatic primary HIV-1 infection. N Engl J Med 1991; 324:954–960.

6. Daar ES, Moudgil T, Meyer RD, Ho DD. Transient high levels of viremia in patients with primary human immunodeficiency virus type 1 infection. N Engl J Med 1991; 324:961–964.

7. Musey L, Hughes J, Schacker T, Shea T, Corey L, McElrath MJ. Cytotoxic-T-cell responses, viral load, and disease progression in early human immunodeficiency virus type 1 infection. N Engl J Med 1997; 337:1267–1274.

8. Bentwich Z, Kalinkovich A, Weisman Z, Grossman Z. Immune activation in the context of HIV infection. Clin Exp Immunol 1998; 111:1–2.

9. Deeks SG, Hoh R, Grant RM, Wrin T, Barbour JD, Narvaez A, et al. CD4+ T cell kinetics and activation in human immunodeficiency virus-infected patients who remain viremic despite long-term treatment with protease inhibitor-based therapy. J Infect Dis 2002; 185:315–323.

10. Giorgi JV, Hultin LE, McKeating JA, Johnson TD, Owens B, Jacobson LP, et al. Shorter survival in advanced human immunodeficiency virus type 1 infection is more closely associated with T lymphocyte activation than with plasma virus burden or virus chemokine coreceptor usage. J Infect Dis 1999; 179:859–870.

11. Sousa AE, Carneiro J, Meier-Schellersheim M, Grossman Z, Victorino RM. CD4 T cell depletion is linked directly to immune activation in the pathogenesis of HIV-1 and HIV-2 but only indirectly to the viral load. J Immunol 2002; 169:3400–3406.

12. Lyles RH, Munoz A, Yamashita TE, Bazmi H, Detels R, Rinaldo CR, et al. Natural history of human immunodeficiency virus type 1 viremia after seroconversion and proximal to AIDS in a large cohort of homosexual men. Multicenter AIDS Cohort Study. J Infect Dis 2000; 181:872–880.

13. Pantaleo G, Demarest JF, Schacker T, Vaccarezza M, Cohen OJ, Daucher M, et al. The qualitative nature of the primary immune response to HIV infection is a prognosticator of disease progression independent of the initial level of plasma viremia. Proc Natl Acad Sci U S A 1997; 94:254–258.

14. Grossman Z, Meier-Schellersheim M, Sousa AE, Victorino RM, Paul WE. CD4+ T-cell depletion in HIV infection: are we closer to understanding the cause? Nat Med 2002; 8:319–323.

15. Hazenberg MD, Hamann D, Schuitemaker H, Miedema F. T cell depletion in HIV-1 infection: how CD4+ T cells go out of stock. Nat Immunol 2000; 1:285–289.

16. Deeks SG, Kitchen CM, Liu L, Guo H, Gascon R, Narvaez AB, et al. Immune activation set point during early HIV infection predicts subsequent CD4+ T-cell changes independent of viral load. Blood 2004; 104:942–947.

17. Bluestone JA, Abbas AK. Natural versus adaptive regulatory T cells. Nat Rev Immunol 2003; 3:253–257.

18. Li S, Gowans EJ, Chougnet C, Plebanski M, Dittmer U. Natural regulatory T cells and persistent viral infection. J Virol 2008; 82:21–30.

19. Belkaid Y, Rouse BT. Natural regulatory T cells in infectious disease. Nat Immunol 2005; 6:353–360.

20. Raghavan S, Holmgren J. CD4+CD25+ suppressor T cells regulate pathogen induced inflammation and disease. FEMS Immunol Med Microbiol 2005; 44:121–127.

21. Aandahl EM, Michaelsson J, Moretto WJ, Hecht FM, Nixon DF. Human CD4+ CD25+ regulatory T cells control T-cell responses to human immunodeficiency virus and cytomegalovirus antigens. J Virol 2004; 78:2454–2459.

22. Kinter AL, Hennessey M, Bell A, Kern S, Lin Y, Daucher M, et al. CD25(+)CD4(+) regulatory T cells from the peripheral blood of asymptomatic HIV-infected individuals regulate CD4(+) and CD8(+) HIV-specific T cell immune responses in vitro and are associated with favorable clinical markers of disease status. J Exp Med 2004; 200:331–343.

23. Weiss L, Donkova-Petrini V, Caccavelli L, Balbo M, Carbonneil C, Levy Y. Human immunodeficiency virus-driven expansion of CD4+CD25+ regulatory T cells, which suppress HIV-specific CD4 T-cell responses in HIV-infected patients. Blood 2004; 104:3249–3256.

24. Belkaid Y. Regulatory T cells and infection: a dangerous necessity. Nat Rev Immunol 2007; 7:875–888.

25. Nilsson J, Boasso A, Velilla PA, Zhang R, Vaccari M, Franchini G, et al. HIV-1-driven regulatory T-cell accumulation in lymphoid tissues is associated with disease progression in HIV/AIDS. Blood 2006; 108:3808–3817.

26. Mozos A, Garrido M, Carreras J, Plana M, Diaz A, Alos L, et al. Redistribution of FOXP3-positive regulatory T cells from lymphoid tissues to peripheral blood in HIV-infected patients. J Acquir Immune Defic Syndr 2007; 46:529–537.

27. Kinter A, McNally J, Riggin L, Jackson R, Roby G, Fauci AS. Suppression of HIV-specific T cell activity by lymph node CD25+ regulatory T cells from HIV-infected individuals. Proc Natl Acad Sci U S A 2007; 104:3390–3395.

28. Epple HJ, Loddenkemper C, Kunkel D, Troger H, Maul J, Moos V, et al. Mucosal but not peripheral FOXP3+ regulatory T cells are highly increased in untreated HIV infection and normalize after suppressive HAART. Blood 2006; 108:3072–3078.

29. Levings MK, Sangregorio R, Sartirana C, Moschin AL, Battaglia M, Orban PC, Roncarolo MG. Human CD25+CD4+ T suppressor cell clones produce transforming growth factor beta, but not interleukin 10, and are distinct from type 1 T regulatory cells. J Exp Med 2002; 196:1335–1346.

30. Seddiki N, Santner-Nanan B, Martinson J, Zaunders J, Sasson S, Landay A, et al. Expression of interleukin (IL)-2 and IL-7 receptors discriminates between human regulatory and activated T cells. J Exp Med 2006; 203:1693–1700.

31. Ziegler SF. FOXP3: of mice and men. Annu Rev Immunol 2006; 24:209–226.

32. Allan SE, Crome SQ, Crellin NK, Passerini L, Steiner TS, Bacchetta R, et al. Activation-induced FOXP3 in human T effector cells does not suppress proliferation or cytokine production. Int Immunol 2007; 19:345–354.

33. Wang J, Ioan-Facsinay A, van der Voort EI, Huizinga TW, Toes RE. Transient expression of FOXP3 in human activated nonregulatory CD4+ T cells. Eur J Immunol 2007; 37:129–138.

34. Walker MR, Carson BD, Nepom GT, Ziegler SF, Buckner JH. De novo generation of antigen-specific CD4+CD25+ regulatory T cells from human CD4+CD25- cells. Proc Natl Acad Sci U S A 2005; 102:4103–4108.

35. Andersson J, Boasso A, Nilsson J, Zhang R, Shire NJ, Lindback S, et al. The prevalence of regulatory T cells in lymphoid tissue is correlated with viral load in HIV-infected patients. J Immunol 2005; 174:3143–3147.

36. Boasso A, Vaccari M, Hryniewicz A, Fuchs D, Nacsa J, Cecchinato V, et al. Regulatory T-cell markers, indoleamine 2,3-dioxygenase, and virus levels in spleen and gut during progressive simian immunodeficiency virus infection. J Virol 2007; 81:11593–11603.

37. Estes JD, Li Q, Reynolds MR, Wietgrefe S, Duan L, Schacker T, et al. Premature induction of an immunosuppressive regulatory T cell response during acute simian immunodeficiency virus infection. J Infect Dis 2006; 193:703–712.

38. Pantaleo G, Graziosi C, Butini L, Pizzo PA, Schnittman SM, Kotler DP, Fauci AS. Lymphoid organs function as major reservoirs for human immunodeficiency virus. Proc Natl Acad Sci U S A 1991; 88:9838–9842.

39. Thornton AM, Shevach EM. Suppressor effector function of CD4+CD25+ immunoregulatory T cells is antigen nonspecific. J Immunol 2000; 164:183–190.

40. Kaufmann DE, Kavanagh DG, Pereyra F, Zaunders JJ, Mackey EW, Miura T, et al. Upregulation of CTLA-4 by HIV-specific CD4+ T cells correlates with disease progression and defines a reversible immune dysfunction. Nat Immunol 2007; 8:1246–1254.

41. Zaunders JJ, Ip S, Munier ML, Kaufmann DE, Suzuki K, Brereton C, et al. Infection of CD127+ (interleukin-7 receptor+) CD4+ cells and overexpression of CTLA-4 are linked to loss of antigen-specific CD4 T cells during primary human immunodeficiency virus type 1 infection. J Virol 2006; 80:10162–10172.

42. Chougnet C, Gessani S. Role of gp120 in dendritic cell dysfunction in HIV infection. J Leukoc Biol 2006; 80:994–1000.

43. Coombes JL, Siddiqui KR, Arancibia-Carcamo CV, Hall J, Sun CM, Belkaid Y, Powrie F. A functionally specialized population of mucosal CD103+ DCs induces Foxp3+ regulatory T cells via a TGF-beta and retinoic acid-dependent mechanism. J Exp Med 2007; 204:1757–1764.

44. Akbar AN, Vukmanovic-Stejic M, Taams LS, Macallan DC. The dynamic co-evolution of memory and regulatory CD4+ T cells in the periphery. Nat Rev Immunol 2007; 7:231–237.

45. Jiang Q, Zhang L, Wang R, Jeffrey J, Washburn ML, Brouwer D, et al. FoxP3+CD4+ Treg cells play an important role in acute HIV-1 infection in humanized rag2-/-{gamma}C-/- mice in vivo. Blood 2008; 112:2858–2868.

46. Kornfeld C, Ploquin MJ, Pandrea I, Faye A, Onanga R, Apetrei C, et al. Antiinflammatory profiles during primary SIV infection in African green monkeys are associated with protection against AIDS. J Clin Invest 2005; 115:1082–1091.

47. Lund JM, Hsing L, Pham TT, Rudensky AY. Coordination of early protective immunity to viral infection by regulatory T cells. Science 2008; 320:1220–1224.

Fig. 1
Fig. 1
Image Tools

Cited By:

This article has been cited 4 time(s).

Blood
The split personality of regulatory T cells in HIV infection
Chevalier, MF; Weiss, L
Blood, 121(1): 29-37.
10.1182/blood-2012-07-409755
CrossRef
Current Hiv Research
Involvement of Regulatory T Cells in HIV Immunopathogenesis
Bernardes, SS; Borges, IK; Lima, JE; Milanez, PDO; Conchon-Costa, I; Felipe, I; Saridakis, HO; Watanabe, MAE
Current Hiv Research, 8(4): 340-346.

Journal of Infectious Diseases
Genomewide Association Study of a Rapid Progression Cohort Identifies New Susceptibility Alleles for AIDS (ANRS Genomewide Association Study 03)
Le Clerc, S; Limou, S; Coulonges, C; Carpentier, W; Dina, C; Taing, L; Delaneau, O; Labib, T; Sladek, R; Deveau, C; Guillemain, H; Ratsimandresy, R; Montes, M; Spadoni, JL; Therwath, A; Schachter, F; Matsuda, F; Gut, I; Lelievre, JD; Levy, Y; Froguel, P; Delfraissy, JF; Hercberg, S; Zagury, JF
Journal of Infectious Diseases, 200(8): 1194-1201.
10.1086/605892
CrossRef
Plos Pathogens
Regulatory T Cells Negatively Affect IL-2 Production of Effector T Cells through CD39/Adenosine Pathway in HIV Infection
Jenabian, MA; Seddiki, N; Yatim, A; Carriere, M; Hulin, A; Younas, M; Ghadimi, E; Kok, A; Routy, JP; Tremblay, A; Sevigny, J; Lelievre, JD; Levy, Y
Plos Pathogens, 9(4): -.
ARTN e1003319
CrossRef
Back to Top | Article Outline
Keywords:

HIV-specific CD4 T cells; IL-10; immune activation; primary HIV infection; regulatory T

© 2008 Lippincott Williams & Wilkins, Inc.

Login

Search for Similar Articles
You may search for similar articles that contain these same keywords or you may modify the keyword list to augment your search.