Skip Navigation LinksHome > November 30, 2008 - Volume 22 - Issue 18 > HIV-1 and HIV-2 produce different amounts of 2-long terminal...
AIDS:
doi: 10.1097/QAD.0b013e328319edab
Research Letters

HIV-1 and HIV-2 produce different amounts of 2-long terminal repeat circular DNA in vitro

Gueudin, Mariea; Braun, Joséphinea; Plantier, Jean-Christophea; Simon, Françoisa,b

Free Access
Article Outline
Collapse Box

Author Information

aLaboratoire de virologie UPRES EA 2656 – Laboratoire associé du centre de référence pour le VIH, CHU Charles Nicolle 76031 ROUEN Cedex, France

bService de Microbiologie – CHU Saint Louis, Paris, France.

Received 16 June, 2008

Revised 8 September, 2008

Accepted 16 September, 2008

Correspondence to Marie Gueudin, Laboratoire de Virologie, CHU Charles Nicolle, 1 rue de Germont, 76031 Rouen Cedex, France. Tel: +33 2 32 88 82 36; fax: +33 2 32 88 04 30; e-mail: Marie.Gueudin@chu-rouen.fr

Collapse Box

Abstract

We assessed HIV-1 and HIV-2 2-long terminal repeat (LTR) circular DNA production in peripheral blood mononuclear cells, MT4-CXCR4 cells and HeLa-CXCR4-CCR5 cells in vitro, relative to the respective total amounts of HIV DNA. Whatever the cell type, HIV-2 produced a smaller total amount of DNA than HIV-1 between 6 and 96 h; HIV-2 2-LTR DNA appeared later than HIV-1 2-LTR DNA, but rapidly became more abundant. This accumulation of HIV-2 2-LTR DNA points to less efficient host cell integration relative to HIV-1.

Accumulation of 2-long terminal repeat (LTR) circular DNA forms has been proposed as a surrogate marker of inefficient HIV-1 integration [1–3]. Few studies have compared the DNA integration rates of HIV-1 and HIV-2 [4]. Recently, using a plasmid containing both the HIV-1 and HIV-2 DNA regions amplified during PCR quantification, we significantly detected smaller amounts of total HIV DNA in HIV-2-infected patients with CD4 above 300/μL than in their HIV-1-infected counterparts [5]. In order to compare 2-LTR DNA production by HIV-1 and HIV-2 in vitro, relative to the total amount of HIV DNA, we synthesized a new plasmid bearing both HIV-1 and HIV-2 2-LTR sequences amplified during PCR quantification of HIV-1 and HIV-2 2-LTR DNA. These fragments span the junction between the two LTR regions of circular DNA and were synthesized with primers 2LTR-HIV1U GTAACTAGAGATCCCTCAGAC, 2LTR-HIV1L ACTAGCTTGAAGCACCATCCA and 2LTR-HIV2U TCCCATCTCTCCTAGTCGC, and 2LTR-HIV2LCTGGCCCATGWGTATARTTYTGC. This HIV-1/HIV-2 LTR plasmid was used as both a calibrator and a standard in the corresponding real-time PCR, allowing us to quantify the two viruses in strictly similar conditions. This new plasmid and the previously reported plasmid, designed for total HIV-1 and HIV-2 DNA quantification [5], were used here to quantify total DNA and 2-LTR DNA produced by the two viruses in human peripheral blood mononuclear cells (PBMC) and cell lines infected in vitro.

The inocula of the prototype strains HIV-1 NL4-3 and HIV-2 ROD, and a strain isolated from an antiretroviral-naive symptomatic patient infected by HIV-2 MEN, were standardized using the tissue culture infectious dose (TCID)50 method based on reverse transcriptase activity (Lenti RT activity kit, Cavidi, Sweden) on the seventh day of culture, and were calculated using the Reed-Muench method [6]. Phytohemagglutinin-activated PBMC from five donors were infected with 500 TCID50 per million cells of HIV-1 NL4-3, HIV-2 ROD or HIV-2 MEN. Cells were pelleted after 6 h and then every 24 h until the two hundred and sixty-fourth hour, and HIV DNA was quantified by means of real-time PCR applied to 1 μg of DNA extract. Total viral DNA was quantified as previously described [5] and the same protocol was used for 2-LTR DNA quantification by adding Pr-2LTR-HIV1: FAM3′CTGGTGTGTAGTTCTGCCAATCAG5′TAMRA to the 2LTR-HIV1 primers for HIV-1 or Pr-2LTR-HIV2: FAM3′AGACCCTGGTCTGTTAGGACCCT5′TAMRA to the 2LTR-HIV2 primers for HIV-2 (annealing temperature 60°C).

Regardless of the PBMC's donor and the HIV-2 strain, a marked difference was found in the kinetics of HIV-1 and HIV-2 DNA production (Fig. 1). The total amount of viral DNA was lower with HIV-2 than with HIV-1, by 1.16 and 0.5 Log, respectively, between 6 and 96 h (HIV-1 NL4-3 versus HIV-2 ROD). After 96 h, total HIV-1 and HIV-2 DNA levels reached a plateau, and the difference was no longer appreciable. Whatever the PBMC donor, the amount of 2-LTR DNA was lower with HIV-2 than with HIV-1 for up to 48 h of culture, but then became higher throughout the remaining culture period (0.65 Log difference between HIV-1 NL4-3 and HIV-2 ROD at the two hundred and sixty-fourth hour). Comparison of MT4-CXCR4 and HeLa-CXCR4-CCR5 cells showed that the results were not influenced by the presence or absence of CCR5.

Fig. 1
Fig. 1
Image Tools

The time lag before 2-LTR HIV-2 DNA production was similar to that observed for total HIV-2 DNA, but the subsequent kinetic pattern was unexpected. Indeed, 2-LTR HIV-2 DNA levels, similar to 2-LTR HIV-1 DNA levels, increased rapidly but, in the plateau phase (at 168 h), 2-LTR circular forms represented only 2% of total HIV-1 NL4-3 DNA copies, compared with 21% and 18% with HIV-2 DNA ROD and MEN, respectively. This difference suggests that HIV-2 may integrate the host cell genome less efficiently than HIV-1, a possibility that would be compatible with the natural history of the two human infections.

Back to Top | Article Outline

Acknowledgments

This work was supported by ANRS. Clotilde Bertin, Fanny Lemerchain, Eléonore Wach, Sébastien Delannoy and Arnaud Fleury performed the technical part of this work. Blood was kindly provided by Etablissement de transfusion sanguine de Normandie. M.G. contributed to the virological and molecular biology studies and manuscript writing and J.B. assisted with the viral culture. J.C. Plantier is the head of the Rouen Virology Laboratory and F.S. is responsible for the study and manuscript writing.

Back to Top | Article Outline

References

1. Saenz DT, Loewen N, Peretz M, Whitwam T, Barraza R, Howell KG, et al. Unintegrated lentivirus DNA persistence and accessibility to expression in nondividing cells: analysis with class I integrase mutants. J Virol 2004; 78:2906–2920.

2. Engelman A, Englund G, Orenstein JM, Martin MA, Craigie R. Multiple effects of mutations in human immunodeficiency virus type 1 integrase on viral replication. J Virol 1995; 69:2729–2736.

3. Butler SL, Hansen MS, Bushman FD. A quantitative assay for HIV DNA integration in vivo. Nat Med 2001; 7:631–634.

4. MacNeil A, Sarr AD, Sankale JL, Meloni ST, Mboup S, Kanki P. Direct evidence of lower viral replication rates in vivo in human immunodeficiency virus type 2 (HIV-2) infection than in HIV-1 infection. J Virol 2007; 81:5325–5330.

5. Gueudin M, Damond F, Braun J, Taieb A, Lemee V, Plantier JC, et al. Differences in proviral DNA load between HIV-1- and HIV-2-infected patients. AIDS 2008; 22:211–215.

6. Knipe DM, Howley PM, editors. Fields' virology. Philadelphia, Pennsylvania: Lippincott Williams & Wilkins; 2001.

© 2008 Lippincott Williams & Wilkins, Inc.

Login