Skip Navigation LinksHome > January 2, 2008 - Volume 22 - Issue 1 > HIV-1 escape to CCR5 coreceptor antagonism through selection...
AIDS:
doi: 10.1097/QAD.0b013e3282f303e6
Basic Science

HIV-1 escape to CCR5 coreceptor antagonism through selection of CXCR4-using variants in vitro

Moncunill, Gemma; Armand-Ugón, Mercedes; Pauls, Eduardo; Clotet, Bonaventura; Esté, José A

Free Access
Article Outline
Collapse Box

Author Information

From the Retrovirology Laboratory IrsiCaixa and AIDS Unit, Hospital Germans Trias i Pujol, Badalona, Spain.

Received 21 June, 2007

Revised 24 September, 2007

Accepted 4 October, 2007

Correspondence to José A. Esté, Retrovirology Laboratory IrsiCaixa and AIDS Unit, Hospital Germans Trias i Pujol, 08916 Badalona, Spain. Tel: +34 934656374; fax: +34 934653968; e-mail: jaeste@irsicaixa.es

Collapse Box

Abstract

Background: HIV-1 coreceptor switch from CCR5 to CXCR4 is associated with disease progression and AIDS. Selection of resistant HIV-1 to CCR5 agents in cell culture has often occurred in the absence of coreceptor switch. With CCR5 antagonists currently in clinical trials, their impact on coreceptor use is still in doubt.

Methods: Six R5 HIV-1 strains were passaged in lymphoid cells expressing high CXCR4 and low CCR5, in the absence or presence of CCR5 inhibitors (TAK-779, mAb 2D7 and CCL5). AMD3100, zidovudine and lamivudine were used as controls. Phenotype and genotype changes as well as virus coreceptor use were evaluated.

Results: In the absence of drug pressure, three out of six strains expanded their coreceptor use to CXCR4 at different times, suggesting that not all virus strains had the capacity to do so. Lowering the replication rate with a suboptimal concentration of different anti-HIV agents (reverse transcriptase inhibitors or CCR5 agents) delayed coreceptor switch. However, virus breakthrough was observed earlier in the presence of CCR5-targeting agents than in presence of reverse transcriptase inhibitors and was associated with a change in sensitivity to TAK-779 or AMD3100, virus coreceptor expansion to CXCR4 and changes in the V3 loop region of gp120.

Conclusion: Our results suggest that HIV-1 may escape CCR5 drug pressure through coreceptor switch. Experimental conditions strongly determine the outcome of CCR5 drug pressure in cell culture. A cell culture model of the evolution of HIV-1 coreceptor use may be relevant to assess the propensity of clinical isolates to develop resistance through coreceptor change.

Back to Top | Article Outline

Introduction

HIV-1 variants can be classified into those that exclusively use CCR5 (R5), CXCR4 (X4) or both coreceptors (R5X4 or dual-tropic viruses) to enter cells [1]. Coreceptor use is determined by the amino acid sequence of HIV gp120, in particular, the number and position of basic residues in the V3 and V1/V2 loops, and less frequently in other regions [2–8]. R5 viruses are characteristic of the asymptomatic stage of infection [9] and are selectively transmitted between individuals [10,11]. However, coreceptor switch from R5 to R5X4 or X4 viruses occurs in around 50% of infected individuals and has been associated with accelerated CD4 T-cell decline and disease progression [12,13]. The mechanisms that prompt the evolution towards CXCR4 use are not fully understood.

HIV-1 entry into host cells is an essential step that offers several potential new targets for antiviral agents [14]. CCR5 and CXCR4 coreceptor antagonists have shown significant potency in cell culture [15–20] and CCR5 inhibitors have shown short-term antiretroviral activity and efficacy in clinical trials [21–25].

Drug-resistant HIV-1 have emerged under the selective pressure of any single antiretroviral agent tested to date [2]. A change in coreceptor use by HIV-1 could be one pathway leading to resistance to coreceptor antagonists [26,27]. Nevertheless, resistance to CCR5-targeting drugs has often been associated with genotypic and phenotypic changes that appear not to promote the emergence of CXCR4-using strains, despite the requirement of few amino acid changes for R5 viruses to switch [28–32]. Given the importance of viral tropism in the evolution of HIV-1 infection, there is a need to elucidate to what extent CCR5 inhibitors can accelerate the emergence of CXCR4-using strains. The cloned R5 168.1 HIV-1 isolate may expand its coreceptor use to CXCR4 in cell culture [33]. Based on this previous result from our laboratory, we designed a culture model that allows for virus coreceptor switch. We evaluated the effect of anti-CCR5 agents on the evolution of different HIV-1 strains with respect to their coreceptor use.

Back to Top | Article Outline

Materials and methods

Cells

Lymphoid Sup-T1 and MT-2 cells were obtained through the MRC Centre for AIDS Reagents. U87 cells expressing CD4 and either CCR5 or CXCR4 [34] were obtained from the NIH AIDS Research and Reference Reagent Program. Cell lines were cultured in RPMI 1640 or DMEM (Invitrogen, Barcelona, Spain) supplemented with 10% heat-inactivated foetal calf serum (FCS) (Innogenetics, Barcelona, Spain) and selection antibiotics when appropriate. Peripheral blood mononuclear cells (PBMC) from six healthy donors were isolated by gradient centrifugation of buffy coat cells obtained from the Catalonia Banc de Sang i Teixits (Barcelona, Spain). PBMC from each donor were mixed equally and resuspended at 50 × 106 PBMC/ml in FCS containing 10% dimethyl sulphoxide (Sigma-Aldrich, Madrid, Spain) frozen and conserved, until need, in liquid nitrogen.

Back to Top | Article Outline
Viruses

The X4 and R5 laboratory-adapted HIV-1 strains NL4-3 and BaL, respectively, were obtained through the MRC AIDS Reagent Program. HIV-1 isolates (CI)1–4, displaying CCR5 tropism were obtained by coculturing PBMC from HIV-1-infected patients with stimulated PBMC from healthy donors. CI5 is a cloned R5 168.1 HIV-1 isolate obtained from a HIV-infected patient [35].

Back to Top | Article Outline
Reagents

TAK-779 and lamivudine (3TC) were obtained from the NIH AIDS Research and Reference Reagent Program. CCL5 (RANTES) was from Peprotech (London, UK). Azidothymidine (ZDV) was from Sigma-Aldrich, and the anti-CCR5 monoclonal antibody (clone 2D7; Becton Dickinson, Madrid, Spain).

Back to Top | Article Outline
Virus titration in PBMC and drug susceptibility assay

PBMC pools were stimulated with 6 U/ml interleukin-2 (Roche, Barcelona, Spain) and 4 μg/ml phytohaemagglutinin for 72 h before use. After stimulation and during the performance of assays, only interleukin-2 at 10 U/ml was used. Viral stocks were titrated as described [36] using the same PBMC pool. Determination of the 50% effective concentration (EC50) of compounds was tested in acute infections, as described previously [37]. Briefly, 1 × 106 pooled PBMC were exposed to 200 TCID50 of virus for 2–3 h at 37°C and 5% CO2. Cells were washed twice with phosphate-buffered saline and seeded (0.1 × 106 cells/well) in the presence of test compounds. After 7 days, supernatant was collected and p24 antigen production was evaluated with a commercial ELISA (Innotest HIV-Ag; Innogenetics, Barcelona, Spain). 50% effective concentrations (EC50) were calculated based on the p24 generated by the virus in presence of compound as described before [38].

Back to Top | Article Outline
Prolonged culture of HIV-1 strains in Sup-T1 cells

Cells (1.5 × 105) were infected with 13 ng p24 antigen from BaL, CI1, CI2, CI3 and CI4 HIV-1. For propagation of the HIV-1 R5 CI5 (168.1 molecular clone) 5 × 106 Sup-T1 were transfected with 2 μg proviral DNA using 0.4 cm cuvettes (BioRad, Madrid, Spain), and 250 V and 950 μF.

Parallel cultures with different inhibitory conditions were maintained for each HIV-1 strain. Twice a week cell cultures were diluted 1: 5 in fresh media either with or without the specific inhibitor. Concentrations for all drugs, except AMD3100 [19], were adjusted to maintain a similar virus replication. Syncytium formation and p24 antigen in the cell supernatant was monitored once a week. When cultures were terminated, viral stocks were generated in Sup-T1 cells in the absence of compound, aliquoted and stored at −80°C. Cell pellets were used for the genetic analysis of proviral forms.

Back to Top | Article Outline
Viral phenotype determination

Coreceptor use was determined by evaluating the infectivity of the viruses in CCR5- or CXCR4- U87-CD4 cells as described previously [39,40]. The X4 phenotype was confirmed by evaluating virus infectivity MT-2 cells as described [36].

Back to Top | Article Outline
Env and reverse transcriptase sequencing

Genomic DNA from infected cells was extracted using the QIAamp DNA Blood Mini Kit (Qiagen, Barcelona, Spain). The Expand High Fidelity PCR System from Roche and the dNTP from Applied Biosystems (Madrid, Spain) were used for PCR amplification of HIV env. Before sequencing the amplified DNA was purified with the QIAquick PCR Purification Kit (Qiagen, Barcelona, Spain).

The env gene (5514–8910) was amplified with primers 5′–GATAAAGCCACCTTTGCCTAGT–3′ and 5′–TTCTAGGTCTCGAGATACTG–3′. Nested PCR for the amplification of the V1–V3 region (6586–7171) was performed using primer pairs 5′–AATTAACCCCACTCTGTGTTAGTTTA–3′ and 5′–GCTCTCCCTGGTCCCCTCTGG–3′. The V3–V5 region (7045–7732) was amplified with primers 5′–CTGCCAATTTCACAGACAATGC–3′ and 5′–CTCTTTGCCTTGGTGGGTGCTA–3′ as previously described [40] and sequenced with the ABI PrismTM BIGDYE Terminator 3.1 kit (Applied Biosystems, Madrid, Spain) in an ABI Prism 3100 Avant Genetic Analyzer. Sequences were analysed with Sequencher v4.5 and edited with the BioEdit software. Amino acid positions were numbered according to the HXB2 strain (Los Alamos database).

Back to Top | Article Outline

Results

Characterization of viral strains for selection with CCR5 inhibitors

Six HIV-1 strains (CI1–CI5 and the laboratory-adapted BaL strain) were selected by their R5 phenotype. Tropism was determined by assessing their growth in MT-2 cells and in U87-CD4 cells expressing the appropriate coreceptor (Table 1). The selected HIV-1 strains were titrated in PBMC and their susceptibility to CXCR4, CCR5 and reverse transcriptase inhibitors (AMD3100, TAK-779 and ZDV respectively) was evaluated (Table 1). As expected, none was sensitive to AMD3100 at the maximum concentration tested (1 μg/ml). All strains were sensitive to TAK-779 and all but one (CI4) had similar sensitivity to ZDV.

Table 1
Table 1
Image Tools
Back to Top | Article Outline
Emergence of HIV-1 coreceptor switch variants in vitro

Virus were passaged in SupT-1 cells which express high levels of CXCR4 and low levels (undetectable by flow cytometry but positive by Western blot analysis) of CCR5 coreceptor [33]. During successive passages viral replication was reminiscent of slow replicating, non-syncitium inducing phenotype. In the absence of drug pressure, three out of six strains (CI3, CI4 and CI5) were able to switch from the R5 to R5/X4 phenotype (Fig. 1, Table 2). Change of phenotype correlated with the observation of syncytia in cell cultures and increased replication rate, as measured by p24 antigen in the supernatant (Fig. 1). After the peak of p24 production there was a drop in p24, probably caused by the massive cell death observed after the spread of R5X4/X4 variants (Fig. 1). The emergence of R5X4 variants from the CI5 culture took place after four passages (14 days) whereas syncytia formation in CI3 and CI4 cultures could be detected at passage 17 (59 days) and 30 (105 days), respectively. Identical experiments were repeated four times with CI5 and twice with CI3 to ensure the reproducibility of coreceptor switch (data not shown). In all cases, the coreceptor switch variants from CI5 and CI3 appeared within 10–16 days and 63–77 days, respectively. The two other clinical isolates (CI1, CI2) and BaL, did not switch coreceptor, despite being 300 days in culture.

Fig. 1
Fig. 1
Image Tools
Table 2
Table 2
Image Tools
Back to Top | Article Outline
CCR5 antagonists accelerated the emergence of CXCR4-using variants compared to reverse transcriptase inhibitors

As explained above, passages of the six HIV-1 strains occurred at relatively slow replication rates due to the low availability of CCR5 coreceptor. At the same time, similar cultures were passaged in the presence of the reverse transcriptase inhibitors, ZDV or 3TC, and the CCR5 antagonist TAK-779 at suboptimal concentrations, applying similar pressure on the virus but on different target genes. The gain of CXCR4 use by the three isolates described above was delayed with ZDV, 3TC and TAK-779 (Fig. 2). In both CI3 and CI5, CXCR4-using viruses emerged earlier with TAK-779 compared to the cultures with ZDV or 3TC. (Fig. 2a, c and Table 2). For CI3, emergence of CXCR4-using variants in the presence of TAK-779 (CI3TAK-779) was delayed for 15 passages (49 days) compared to the untreated control (CI3C), whereas ZDV delayed it (CI3ZDV) for 21 passages (70 days). The CI5 strain cultured with TAK-779 (CI5TAK-779) switched coreceptor at 5–9 passages (17–59 days) after the CI5 without drug (CI5C), depending on the experiment. Coreceptor switch variants of CI5 in the presence of ZDV (CI5ZDV) could not be detected even 18 or 33 passages (63 or 115 days) after their detection in the control cultures.

Fig. 2
Fig. 2
Image Tools

CI4 in the presence of ZDV (CI4ZDV) switched coreceptor earlier than in presence of TAK-779 (CI4TAK-779) (Fig. 2b and Table 2). This virus strain was shown resistant to ZDV by phenotype (Table 1) and genotype testing (data not shown). The emergence of X4 viruses in the presence of ZDV (CI4ZDV) took place only three passages (11 days) after detection of CXCR4-using variants in the cultures without drugs (CI4C).

A parallel culture of each strain was maintained with AMD3100 (1 μg/ml). AMD3100 prevented the emergence of CXCR4-using viruses in the cultures of the three clinical isolates that switched in the absence of drug pressure.

Selection of the R5X4 phenotype could also be induced with the monoclonal antibody (mAb) anti-CCR5 2D7 and RANTES (Fig. 2d). The switch of coreceptor use was delayed if compared to the untreated culture, but was noticed earlier with all CCR5 agents when compared to cultures growing at a similar replication rate (in the presence of ZDV or 3TC).

Back to Top | Article Outline
Tropism change accompanied by reduced sensitivity to TAK-779

The sensitivity to ZDV, AMD3100 and TAK-779 of each parental virus and all the viruses obtained after the passages was determined in PBMC. EC50 values are shown in Table 2. As expected, almost all the viruses that gained CXCR4 usage were less sensitive to TAK-779. The control CI5 virus (control CI5, CI5C), of R5X4 phenotype, was 30-fold less sensitive to TAK-779 compared to the parental CI5 (EC50 0.003 μg/ml and 0.0001 μg/ml, respectively). Similarly, the EC50 of TAK-779 for CI5TAK-779 and CI5RANTES increased 30-fold and 100-fold for the CI52D7 strain. Comparable results were obtained with the CI3 virus, the switched variants were 40-fold (CI3C) 90-fold (CI3ZDV) and 60-fold (CI3TAK-779) less sensitive to TAK-779. Nevertheless, the R5X4 variant CI4ZDV was as sensitive as the CI4 parental isolate. Concerning the AMD3100 inhibition, parental isolates were totally resistant, but the R5X4 variants gained some sensitivity. However, an EC50 value for AMD3100 could not be calculated, except in two cases, for CI3C (0.03 μg/ml) and for CI4C (0.1 μg/ml). Drug sensitivity in primary cells is prone to higher variation in experimental error and variation in virus titre may explain the 10-fold increase in the AMD3100, ZDV and 3TC CI5 passaged strains.

Back to Top | Article Outline
Genotypic changes in gp120 of coreceptor switch variants

Amino acid changes associated with virus coreceptor switch are shown in Fig. 3. Most of the mutations occurred in the V3 loop and substitutions that generated the positively charged amino acids Arg (R) or Lys (K) were heavily favoured, mainly in V3 (e.g., CI4C, CI5C, CI5TAK-779), but also in V2 (CI4C). Changes in the V3 loop net charge have been previously associated with coreceptor switch [35,41,42]. We observe a potential glycosylation site loss in V3 at position 301 (CI5C, CI5TAK-779.2, CI52D7), that has also been associated with coreceptor switch [43]. No other mutations in the gp120 coding region were observed (data not shown). Notably, almost all viral strains that switched coreceptor had a glycine (G) to arginine (R) mutation at position 314 in V3 loop. However, one experiment with the CI5 passaged with TAK-779 (CI5TAK-779.1) showed the emergence of an aspartic acid (D) to an asparagine (N) at position 322 in V3, increasing the V3 net positive charge and the loss of the N-linked glycosilation site at position 301.

Fig. 3
Fig. 3
Image Tools
Back to Top | Article Outline

Discussion

A number of publications have suggested that CCR5 drug resistance may emerge in the absence of coreceptor switch [28–32]. HIV-1 may become resistant to vicriviroc [28,44] or maraviroc [32] by utilizing an inhibitor-bound form of the receptor and this has been shown as a preferential mode to circumvent the anti-HIV activity of CCR5 drugs in the absence of coreceptor switch. Coreceptor phenotype testing from the phase II maraviroc trial showed that circulating virus remained CCR5 tropic in 60/62 patients, indicating that X4 variants were not rapidly selected despite CCR5-specific drug pressure [45]. Conversely, we show that in cell culture, HIV-1 strains may switch to CXCR4 use faster with selective pressure on CCR5 use (TAK-779, RANTES or 2D7) than with ZDV, suggesting a preferential selection of X4 virus as a mode of drug resistance in some of the HIV strains tested.

The use of CCR5-targeting drugs requires the prior knowledge of the viral tropism in a given patient. Determination for HIV-1 coreceptor usage is complex and only few methods exist [46,47] that may not be sensitive enough to detect minor X4 or R5/X4 populations [45–50], selection of which would be favoured by a CCR5 antagonist. For instance, X4 variants in two patients on treatment with maraviroc appeared to emerge by outgrowth of a pretreatment CXCR4-using reservoir [45].

Our observation that a clonal R5 virus may gain CXCR4 use, which also occurred in the presence of CCR5 compounds, shows that minor X4 populations may evolve from the mutants generated within the first 2 weeks from a purely R5 virus. Furthermore, if a minor X4 population is present at the initiation of cell culture, it is intuitive to think that X4 emergence will occur at a similar time/rate in the absence or presence of CCR5 drugs and this did not occur. It is also relevant to bear in mind that for any given compound, the selection of a resistant virus applies for a preexisting minor mutant population with a selective advantage in the presence of the drug. Generation of the mutant virus depends on the intrinsic mutation rate and the replicative capacity of the virus. Therefore, whether the drug-resistant virus (i.e., a CXCR4-using strain) was present at day zero or was generated during cell culture, the emergence of the mutant is independent of the drug that, if present, selects for the drug-resistant virus.

Our results are in line with a recent report of the maraviroc phase III trial concluding that more patients on maraviroc had a change in tropism to dual tropic/mix (R5/X4) or X4 at time of failure than in the placebo control group [24], underscoring the propensity of CXCR4-using virus to emerge under CCR5 drug pressure. Upon discontinuation of treatment, R5 virus may repopulate and conform the dominating phenotype, suggesting that X4 variants may only have an increased viral fitness in the presence of CCR5 drug pressure.

The X4 variants that emerged in our cultures gained sensitivity to AMD3100 and lost it to TAK-779. However, changes in susceptibility to both compounds were partial, reflecting the retained capacity of the virus to use CCR5 or CXCR4. Notably, one virus strain expanded coreceptor capacity while retaining total sensitivity to TAK-779 in PBMC. Coreceptor switch intermediates with lower affinity to CCR5 and higher sensitivity to CCR5 inhibitors have been recently described [51]. These results were generated in U87-CD4 cells that exclusively express CCR5, allowing evaluation of changes in sensitivity due to changes in the affinity of the virus for the receptor. Reduced or loss of sensitivity to TAK-779 of HIV-1 stains in PBMC cultures, i.e., expressing both CCR5 and CXCR4, probably reflects increased representation of CXCR4-using variants within the virus population that grow out in the presence of drug, and not a correlative measurement of CCR5 binding. Dualtropic viruses exhibit considerable variations in their efficiency to use CXCR4 and CCR5 as coreceptor [52], and consequently, in their susceptibility to CXCR4 and CCR5 entry inhibitors. HIV-1 strains such as 89.6, defined as dualtropic through coreceptor assays, may be completely blocked by AMD3100 in PBMC and ex vivo lymphoid tissue [53]. Tests for coreceptor use and drug sensitivity in cells expressing both coreceptors [52] may not always be in agreement, highlighting the necessity of multiple determinations to clearly assess coreceptor preference by HIV-1.

Evolution towards CXCR4 usage in vivo and in vitro seems to go along multiple pathways and most R5X4/X4 variants have diverse mutation patterns, although some common features (i.e., charged amino acids at position 11/25 of the V3 loop) have been detected [54,55]. We observed that the R5 isolates gained CXCR4 use via multiple mutations in gp120. With the exception of CI5 in the presence of TAK-779, which showed two different patterns of mutations, a common mutation (G314R) was observed in independent switch variants. This mutation is uncommon but some cases have been reported [56–59] and it has been associated with gain of CXCR4 use in vitro [41,51,60]. We have shown that HIV-1 CI5 may expand its coreceptor use in cell culture and this may be prevented by CXCR4 antagonists [33]. The emergence of CXCR4 variants required 100 days rather than 10–16 days as shown herein and did not involve the G-to-R mutation at position 314 but the canonical changes at positions 11 and 25 of the V3 loop. A faster coreceptor switch may occur by passaging both infected cells and supernatant and not virus-containing supernatant alone. It is also possible that cell to cell transmission may favour virus coreceptor switch and allow for a different pattern of mutations.

In this cell culture model not all strains were able to switch coreceptor preference, which may reflect an intrinsic capacity of some isolates to switch to X4 or retain the R5 phenotype. It is enticing to suggest the importance of evaluating a significant number of isolates in order to validate if cell culture assays could be used to measure the propensity of a clinical isolate to switch or expand coreceptor preference prior to or after the initiation of a CCR5 drug-containing regimen. It will also be important to determine by clonal analysis if the emerging X4 phenotype is generated by a mixture of R5 and emerging X4 variants, or are dual-tropic (R5X4) viruses.

It becomes clear that cell culture conditions and choice of virus isolate are of utmost importance to induce a coreceptor change in cell culture. This observation can be extended to the development of resistance to CCR5 inhibitors in the absence of coreceptor switch. The virus strains that did not switch coreceptor preference did not become resistant to TAK-779 at the time that cell cultures were stopped (data not shown for CI1, CI2 and BaL). Resistance is commonly developed in cells expressing detectable CCR5 levels and by gradually increasing the compound concentration until relatively high levels are reached [29–31]. The cell type, time in culture and the concentration of HIV inhibitors together with the specific HIV-1 strain that is being selected are factors that affect the outcome of in vitro resistance development.

While lacking long-term in vivo studies, our work provides important information on the role of CCR5 antagonists in coreceptor switch. We highlight the possibility of developing CXCR4-tropic HIV variants induced by CCR5 antagonists and suggest that CXCR4 agents may be used to prevent the emergence of X4 HIV strains alone or in combination with CCR5 agents.

Back to Top | Article Outline

Acknowledgements

We thank the NIH AIDS Reference Reagent Program for reagents. This work was supported in part by the Spanish MEC project BFU2006-00966, FIS PI060624 and Red de Investigación sobre el SIDA and the European TRIoH Consortium (LSHB-CT-2003-503480). G. Moncunill is recipient of a scholarship from Generalitat de Catalunya.

Back to Top | Article Outline

References

1. Berger EA, Doms RW, Fenyo EM, Korber BT, Littman DR, Moore JP, et al. A new classification for HIV-1. Nature 1998; 391:240.

2. Menendez-Arias L, Este JA. HIV-resistance to viral entry inhibitors. Curr Pharm Des 2004; 10:1845–1860.

3. Bjorndal A, Deng H, Jansson M, Fiore JR, Colognesi C, Karlsson A, et al. Coreceptor usage of primary human immunodeficiency virus type 1 isolates varies according to biological phenotype. J Virol 1997; 71:7478–7487.

4. Carrillo A, Ratner L. Human immunodeficiency virus type 1 tropism for T-lymphoid cell lines: role of the V3 loop and C4 envelope determinants. J Virol 1996; 70:1301–1309.

5. Chan SY, Speck RF, Power C, Gaffen SL, Chesebro B, Goldsmith MA. V3 recombinants indicate a central role for CCR5 as a coreceptor in tissue infection by human immunodeficiency virus type 1. J Virol 1999; 73:2350–2358.

6. Cocchi F, DeVico AL, Garzino-Demo A, Cara A, Gallo RC, Lusso P. The V3 domain of the HIV-1 gp120 envelope glycoprotein is critical for chemokine-mediated blockade of infection. Nat Med 1996; 2:1244–1247.

7. Hwang SS, Boyle TJ, Lyerly HK, Cullen BR. Identification of the envelope V3 loop as the primary determinant of cell tropism in HIV-1. Science 1991; 253:71–74.

8. Pastore C, Nedellec R, Ramos A, Pontow S, Ratner L, Mosier DE. Human immunodeficiency virus type 1 coreceptor switching: V1/V2 gain-of-fitness mutations compensate for V3 loss-of-fitness mutations. J Virol 2006; 80:750–758.

9. Connor RI, Sheridan KE, Ceradini D, Choe S, Landau NR. Change in coreceptor use coreceptor use correlates with disease progression in HIV-1–infected individuals. J Exp Med 1997; 185:621–628.

10. Deng H, Liu R, Ellmeier W, Choe S, Unutmaz D, Burkhart M, et al. Identification of a major co-receptor for primary isolates of HIV-1. Nature 1996; 381:661–666.

11. Liu R, Paxton WA, Choe S, Ceradini D, Martin SR, Horuk R, et al. Homozygous defect in HIV-1 coreceptor accounts for resistance of some multiply-exposed individuals to HIV-1 infection. Cell 1996; 86:367–377.

12. Koot M, Keet IP, Vos AH, de Goede RE, Roos MT, Coutinho RA, et al. Prognostic value of HIV-1 syncytium-inducing phenotype for rate of CD4+ cell depletion and progression to AIDS. Ann Intern Med 1993; 118:681–688.

13. Richman DD, Bozzette SA. The impact of the syncytium-inducing phenotype of human immunodeficiency virus on disease progression. J Infect Dis 1994; 169:968–974.

14. Este JA, Telenti A. HIV entry inhibitors. Lancet 2007; 370:81–88.

15. Baba M, Nishimura O, Kanzaki N, Okamoto M, Sawada H, Iizawa Y, et al. A small-molecule, nonpeptide CCR5 antagonist with highly potent and selective anti-HIV-1 activity. Proc Natl Acad Sci USA 1999; 96:5698–5703.

16. Dorr P, Westby M, Dobbs S, Griffin P, Irvine B, Macartney M, et al. Maraviroc (UK-427 857), a potent, orally bioavailable, and selective small-molecule inhibitor of chemokine receptor CCR5 with broad-spectrum antihuman immunodeficiency virus type 1 activity. Antimicrob Agents Chemother 2005; 49:4721–4732.

17. Willey S, Peters PJ, Sullivan WM, Dorr P, Perros M, Clapham PR. Inhibition of CCR5-mediated infection by diverse R5 and R5X4 HIV and SIV isolates using novel small molecule inhibitors of CCR5: effects of viral diversity, target cell and receptor density. Antiviral Res 2005; 68:96–108.

18. Strizki JM, Tremblay C, Xu S, Wojcik L, Wagner N, Gonsiorek W, et al. Discovery and characterization of vicriviroc (SCH 417690), a CCR5 antagonist with potent activity against human immunodeficiency virus type 1. Antimicrob Agents Chemother 2005; 49:4911–4919.

19. Donzella GA, Schols D, Lin SW, Este JA, Nagashima KA, Maddon PJ, et al. AMD3100, a small molecule inhibitor of HIV-1 entry via the CXCR4 co-receptor. Nat Med 1998; 4:72–77.

20. Este JA. Virus entry as a target for anti-HIV intervention. Curr Med Chem 2003; 10:1617–1632.

21. Este JA, Telenti A. HIV entry inhibitors. Lancet 2007; 370:81–88.

22. Gulick RM, Su Z, Flexner C, Hughes MD, Skolnik PR, Wilkin TJ, et al. Phase 2 study of the safety and efficacy of vicriviroc, a CCR5 inhibitor, in HIV-1-infected, treatment-experienced patients: AIDS Clinical Trials Group 5211. J Infect Dis 2007; 196:304–312.

23. Lalezari JG, DeJesus E, Lampiris H, Gulick R, Saag M, Bridgway C, et al. Efficacy and safety of maraviroc plus optimized background therapy in viremic ART-experienced patients infected with CCR5-tropic HIV-1: 24-week results of a Phase 2b/3 study in the US and Canada. Fourteenth Conference on Retroviruses and Opportunistic Infections. Los Angeles, CA, February 2007; 2007 [abstract 104bLB].

24. Nelson M, Konourina I, Lazzarin A, Clumeck N, Horban A, Tawadrous M. Efficacy and safety of maraviroc plus optimized background therapy in viremic, ART-experienced patients infected with CCR5-tropic HIV-1 in Europe, Australia, and North America: 24-Week Results. Fourteenth Conference on Retroviruses and Opportunistic Infections. Los Angeles, CA, February 2007; 2007 [abstract 104bLB].

25. Clotet B. CCR5 inhibitors: promising yet challenging. J Infect Dis 2007; 196:178–180.

26. Moore JP, Kitchen SG, Pugach P, Zack JA. The CCR5 and CXCR4 coreceptors–central to understanding the transmission and pathogenesis of human immunodeficiency virus type 1 infection. AIDS Res Hum Retroviruses 2004; 20:111–126.

27. Nishikawa M, Takashima K, Nishi T, Furuta RA, Kanzaki N, Yamamoto Y, et al. Analysis of binding sites for the new small-molecule CCR5 antagonist TAK-220 on human CCR5. Antimicrob Agents Chemother 2005; 49:4708–4715.

28. Kuhmann SE, Pugach P, Kunstman KJ, Taylor J, Stanfield RL, Snyder A, et al. Genetic and phenotypic analyses of human immunodeficiency virus type 1 escape from a small-molecule CCR5 inhibitor. J Virol 2004; 78:2790–2807.

29. Marozsan AJ, Kuhmann SE, Morgan T, Herrera C, Rivera-Troche E, Xu S, et al. Generation and properties of a human immunodeficiency virus type 1 isolate resistant to the small molecule CCR5 inhibitor, SCH-417690 (SCH-D). Virology 2005; 338:182–199.

30. Trkola A, Kuhmann SE, Strizki JM, Maxwell E, Ketas T, Morgan T, et al. HIV-1 escape from a small molecule, CCR5-specific entry inhibitor does not involve CXCR4 use. Proc Natl Acad Sci USA 2002; 99:395–400.

31. Baba M, Miyake H, Wang X, Okamoto M, Takashima K. Isolation and characterization of human immunodeficiency virus type 1 resistant to the small-molecule CCR5 antagonist TAK-652. Antimicrob Agents Chemother 2007; 51:707–715.

32. Westby M, Smith-Burchnell C, Mori J, Lewis M, Mosley M, Stockdale M, et al. Reduced maximal inhibition in phenotypic susceptibility assays indicates that viral strains resistant to the CCR5 antagonist maraviroc utilize inhibitor-bound receptor for entry. J Virol 2007; 81:2359–2371.

33. Este JA, Cabrera C, Blanco J, Gutierrez A, Bridger G, Henson G, et al. Shift of clinical human immunodeficiency virus type 1 isolates from X4 to R5 and prevention of emergence of the syncytium-inducing phenotype by blockade of CXCR4. J Virol 1999; 73:5577–5585.

34. Pauls E, Senserrich J, Clotet B, Este JA. Inhibition of HIV-1 replication by RNA interference of p53 expression. J Leukoc Biol 2006; 80:659–667.

35. de Jong JJ, Goudsmit J, Keulen W, Klaver B, Krone W, Tersmette M, et al. Human immunodeficiency virus type 1 clones chimeric for the envelope V3 domain differ in syncytium formation and replication capacity. J Virol 1992; 66:757–765.

36. NIAID and NIH. NIAID and NIH Virology Manual for HIV Laboratories. Washington DC: National Institute of Allergy and Infectious Diseases; Publication NIH-97-3828 1997.

37. Moncunill G, Negredo E, Bosch L, Vilarrasa J, Witvrouw M, Llano A, et al. Evaluation of the anti-HIV activity of statins. AIDS 2005; 19:1697–1700.

38. Bosch B, Clotet-Codina I, Blanco J, Pauls E, Coma G, Cedeno S, et al. Inhibition of human immunodeficiency virus type 1 infection in macrophages by an alpha-v integrin blocking antibody. Antiviral Res 2006; 69:173–180.

39. Martinez MA, Gutierrez A, Armand-Ugon M, Blanco J, Parera M, Gomez J, et al. Suppression of chemokine receptor expression by RNA interference allows for inhibition of HIV-1 replication. AIDS 2002; 16:2385–2390.

40. Armand-Ugón M, Clotet-Codina I, Tintori C, Manetti F, Clotet B, Botta M, et al. The anti-HIV activity of ADS-J1 targets the HIV-1 gp120. Virology 2005; 343:141–149.

41. Pastore C, Ramos A, Mosier DE. Intrinsic obstacles to human immunodeficiency virus type 1 coreceptor switching. J Virol 2004; 78:7565–7574.

42. Fouchier RA, Groenink M, Kootstra NA, Tersmette M, Huisman HG, Miedema F, et al. Phenotype-associated sequence variation in the third variable domain of the human immunodeficiency virus type 1 gp120 molecule. J Virol 1992; 66:3183–3187.

43. Pollakis G, Kang S, Kliphuis A, Chalaby MI, Goudsmit J, Paxton WA. N-linked glycosylation of the HIV type-1 gp120 envelope glycoprotein as a major determinant of CCR5 and CXCR4 coreceptor utilization. J Biol Chem 2001; 276:13433–13441.

44. Pugach P, Marosan A, Ketas T, Landes E, Mooore J, Kuhmann S. HIV-1 clones resistant to a small molecule CCR5 inhibitor use the inhibitor-bound form of CCR5 for entry. Virology 2007; 361:212–228.

45. Westby M, Lewis M, Whitcomb J, Youle M, Pozniak AL, James IT, et al. Emergence of CXCR4-using human immunodeficiency virus type 1 (HIV-1) variants in a minority of HIV-1-infected patients following treatment with the CCR5 antagonist maraviroc is from a pretreatment CXCR4-using virus reservoir. J Virol 2006; 80:4909–4920.

46. Whitcomb JM, Huang W, Fransen S, Limoli K, Toma J, Wrin T, et al. Development and characterization of a novel single-cycle recombinant-virus assay to determine human immunodeficiency virus type 1 coreceptor tropism. Antimicrob Agents Chemother 2007; 51:566–575.

47. Coakley E, Petropoulos CJ, Whitcomb JM. Assessing chemokine co-receptor usage in HIV. Curr Opin Infect Dis 2005; 18:9–15.

48. Wilkin TJ, Su Z, Kuritzkes DR, Hughes M, Flexner C, Gross R, et al. HIV type 1 chemokine coreceptor use among antiretroviral-experienced patients screened for a clinical trial of a CCR5 inhibitor: AIDS Clinical Trial Group A5211. Clin Infect Dis 2007; 44:591–595.

49. Jensen MA, van 't Wout AB. Predicting HIV-1 coreceptor usage with sequence analysis. AIDS Rev 2003; 5:104–112.

50. Fernandez G, Llano A, Esgleas M, Clotet B, Este JA, Martinez MA. Purifying selection of CCR5-tropic human immunodeficiency virus type 1 variants in AIDS subjects that have developed syncytium-inducing, CXCR4-tropic viruses. J Gen Virol 2006; 87:1285–1294.

51. Pastore C, Nedellec R, Ramos A, Hartley O, Miamidian JL, Reeves JD, et al. Conserved changes in envelope function during human immunodeficiency virus type 1 coreceptor switching. J Virol 2007; 81:8165–8179.

52. Reeves JD, Gallo SA, Ahmad N, Miamidian JL, Harvey PE, Sharron M, et al. Sensitivity of HIV-1 to entry inhibitors correlates with envelope/coreceptor affinity, receptor density, and fusion kinetics. Proc Natl Acad Sci USA 2002; 99:16249–16254.

53. Yi Y, Shaheen F, Collman RG. Preferential use of CXCR4 by R5X4 human immunodeficiency virus type 1 isolates for infection of primary lymphocytes. J Virol 2005; 79:1480–1486.

54. Jensen MA, Li FS, van 't Wout AB, Nickle DC, Shriner D, He HX, et al. Improved coreceptor usage prediction and genotypic monitoring of R5-to-X4 transition by motif analysis of human immunodeficiency virus type 1 env V3 loop sequences. J Virol 2003; 77:13376–13388.

55. Hoffman NG, Seillier-Moiseiwitsch F, Ahn J, Walker JM, Swanstrom R. Variability in the human immunodeficiency virus type 1 gp120 Env protein linked to phenotype-associated changes in the V3 loop. J Virol 2002; 76:3852–3864.

56. LaRosa GJ, Davide JP, Weinhold K, Waterbury JA, Profy AT, Lewis JA, et al. Conserved sequence and structural elements in the HIV-1 principal neutralizing determinant. Science 1990; 249:932–935.

57. Voulgaropoulou F, Tan B, Soares M, Hahn B, Ratner L. Distinct human immunodeficiency virus strains in the bone marrow are associated with the development of thrombocytopenia. J Virol 1999; 73:3497–3504.

58. Troyer RM, Collins KR, Abraha A, Fraundorf E, Moore DM, Krizan RW, et al. Changes in human immunodeficiency virus type 1 fitness and genetic diversity during disease progression. J Virol 2005; 79:9006–9018.

59. Shankarappa R, Margolick JB, Gange SJ, Rodrigo AG, Upchurch D, Farzadegan H, et al. Consistent viral evolutionary changes associated with the progression of human immunodeficiency virus type 1 infection. J Virol 1999; 73:10489–10502.

60. Holuigue S, Ketas T, Moore J. Co-receptor switched and CCR5 inhibitor-resistant HIV-1 variants are generated in response to different selection pressures in vitro. Fourteenth Conference on Retroviruses and Opportunistic Infections. Los Angeles, CA, February 2007; 2007 [abstract 164].

Cited By:

This article has been cited 18 time(s).

Molecular Pharmacology
Anti-HIV activity and resistance profile of the CXC chemokine receptor 4 antagonist POL3026
Moncunill, G; Armand-Ugon, M; Clotet-Codina, I; Pauls, E; Ballana, E; Llano, A; Romagnoli, B; Vrijbloed, JW; Gombert, FO; Clotet, B; De Marco, S; Este, JA
Molecular Pharmacology, 73(4): 1264-1273.
10.1124/mol.107.042911
CrossRef
Journal of Medicinal Chemistry
5-alkyl-6-benzyl-2-(2-oxo-2-phenylethylsulfanyl)pyrimidin-4(3H)-ones, a series of anti-HIV-1 agents of the dihydro-alkoxy-benzyl-oxopyrimidine family with peculiar structure-activity relationship profile
Nawrozkij, MB; Rotili, D; Tarantino, D; Botta, G; Eremiychuk, AS; Musmuca, I; Ragno, R; Samuele, A; Zanoli, S; Armand-Ugon, M; Clotet-Codina, I; Novakov, IA; Orlinson, BS; Maga, G; Este, JA; Artico, M; Mai, A
Journal of Medicinal Chemistry, 51(): 4641-4652.
10.1021/jm800340w
CrossRef
Antiviral Research
HIV endocytosis after dendritic cell to T cell viral transfer leads to productive virus infection
Clotet-Codina, I; Bosch, B; Senserrich, J; Fernandez-Figueras, MT; Pena, R; Ballana, E; Bofill, M; Clotet, B; Este, JA
Antiviral Research, 83(1): 94-98.
10.1016/j.antiviral.2009.03.009
CrossRef
Nature Chemical Biology
A synthetic CD4-heparan sulfate glycoconjugate inhibits CCR5 and CXCR4 HIV-1 attachment and entry
Baleux, F; Loureiro-Morais, L; Hersant, Y; Clayette, P; Arenzana-Seisdedos, F; Bonnaffe, D; Lortat-Jacob, H
Nature Chemical Biology, 5(): 743-748.
10.1038/nchembio.207
CrossRef
Journal of Antimicrobial Chemotherapy
Different selection patterns of resistance and cross-resistance to HIV-1 agents targeting CCR5
Armand-Ugon, M; Moncunill, G; Gonzalez, E; Mena, M; Ballana, E; Clotet, B; Este, JA
Journal of Antimicrobial Chemotherapy, 65(3): 417-424.
10.1093/jac/dkp482
CrossRef
Journal of Antimicrobial Chemotherapy
New developments in HIV drug resistance
Cane, PA
Journal of Antimicrobial Chemotherapy, 64(4): 37-40.
10.1093/jac/dkp258
CrossRef
Antiviral Research
A clathrin-dynamin-dependent endocytic pathway for the uptake of HIV-1 by direct T cell-T cell transmission
Bosch, B; Grigorov, B; Senserrich, J; Clotet, B; Darlix, JL; Muriaux, D; Este, JA
Antiviral Research, 80(2): 185-193.
10.1016/j.antiviral.2008.06.004
CrossRef
Bioorganic & Medicinal Chemistry Letters
A dynamic target-based pharmacophoric model mapping the CD4 binding site on HIV-1 gp120 to identify new inhibitors of gp120-CD4 protein-protein interactions
Caporuscio, F; Tafi, A; Gonzalez, E; Manetti, F; Este, JA; Botta, M
Bioorganic & Medicinal Chemistry Letters, 19(): 6087-6091.
10.1016/j.bmcl.2009.09.029
CrossRef
Chemmedchem
Substrate-induced stable enzyme-inhibitor complex formation allows tight binding of novel 2-aminopyrimidin-4(3H)-ones to drug-resistant HIV-1 reverse transcriptase mutants
Samuele, A; Facchini, M; Rotili, D; Mai, A; Artico, M; Armand-Ugon, M; Este, JA; Maga, G
Chemmedchem, 3(9): 1412-1418.
10.1002/cmdc.200800051
CrossRef
Biochemical Pharmacology
The AMD3100 story: The path to the discovery of a stem cell mobilizer (Mozobil)
De Clercq, E
Biochemical Pharmacology, 77(): 1655-1664.
10.1016/j.bcp.2008.12.014
CrossRef
Blood
Cell adhesion through alpha V-containing integrins is required for efficient HIV-1 infection in macrophages
Ballana, E; Pauls, E; Senserrich, J; Clotet, B; Perron-Sierra, F; Tucker, GC; Este, JA
Blood, 113(6): 1278-1286.
10.1182/blood-2008-06-161869
CrossRef
Expert Opinion on Therapeutic Patents
Circular CCR5 peptide conjugates and uses thereof (WO2008074895)
Sommerfelt, MA
Expert Opinion on Therapeutic Patents, 19(9): 1323-1328.
10.1517/13543770902967682
CrossRef
AIDS Reviews
HIV-1 drug resistance mutations: an updated framework for the second decade of HAART
Shafer, RW; Schapiro, JM
AIDS Reviews, 10(2): 67-84.

Chemmedchem
Discovery of Novel Non-Cyclam Polynitrogenated CXCR4 Coreceptor Inhibitors
Pettersson, S; Perez-Nueno, VI; Ros-Blanco, L; de La Bellacasa, RP; Rabal, MO; Batllori, X; Clotet, B; Clotet-Codina, I; Armand-Ugon, M; Este, J; Borrell, JI; Teixido, J
Chemmedchem, 3(): 1549-1557.
10.1002/cmdc.200800145
CrossRef
AIDS Reviews
HIV-1 Genotypic Drug Resistance Interpretation Rules-2009 Spanish Guidelines
de Mendoza, C; Anta, L; Garcia, F; Perez-Elias, J; Gutierrez, F; Llibre, JM; Menendez-Arias, L; Dalmau, D; Soriano, V
AIDS Reviews, 11(1): 39-51.

Medicinal Research Reviews
Antiviral Drug Discovery: Ten More Compounds, and Ten More Stories (Part B)
De Clercq, E
Medicinal Research Reviews, 29(4): 571-610.
10.1002/med.20149
CrossRef
Clinical Infectious Diseases
ZNRD1 (Zinc Ribbon Domain-Containing 1) Is a Host Cellular Factor That Influences HIV-1 Replication and Disease Progression
Ballana, E; Senserrich, J; Pauls, E; Faner, R; Mercader, JM; Uyttebroeck, F; Palou, E; Mena, MP; Grau, E; Clotet, B; Ruiz, L; Telenti, A; Ciuffi, A; Este, JA
Clinical Infectious Diseases, 50(7): 1022-1032.
10.1086/651114
CrossRef
AIDS
Evaluation of the anti-HIV activity of natalizumab, an antibody against integrin alpha4
Ramo-Tello, C; Esté, JA; Pauls, E; Ballana, E; Moncunill, G; Bofill, M; Clotet, B
AIDS, 23(2): 266-268.
10.1097/QAD.0b013e328320a7f8
PDF (890) | CrossRef
Back to Top | Article Outline
Keywords:

CCR5; CCR5 antagonists; coreceptor switch; CXCR4; HIV-1; resistance

© 2008 Lippincott Williams & Wilkins, Inc.

Login

Search for Similar Articles
You may search for similar articles that contain these same keywords or you may modify the keyword list to augment your search.