Skip Navigation LinksHome > December 2007 - Volume 21 - Issue > A novel fusion gene, TRIM5-Cyclophilin A in the pig-tailed m...
AIDS:
doi: 10.1097/01.aids.0000304692.09143.1b
Original papers

A novel fusion gene, TRIM5-Cyclophilin A in the pig-tailed macaque determines its susceptibility to HIV-1 infection

Liao, Cheng-Honga,b,d,†; Kuang, Yi-Quna,c,d,†; Liu, Hong-Lianga,c,d; Zheng, Yong-Tanga,c; Su, Binga,b

Free Access
Article Outline
Collapse Box

Author Information

From the aKunming Primate Research Center, China

bState Key Laboratory of Genetic Resources and Evolution, China

cLaboratory of Molecular Immunopharmacology, Key Laboratory of Animal Models and Human Disease Mechanisms, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, China

dGraduate School of Chinese Academy of Sciences, Beijing, China.

*These authors contributed equally to this work.

Correspondence to Bing Su, Kunming Primate Research Center, or Yong-Tang Zheng, Laboratory of Molecular Immunopharmacology, Kunming Institute of Zoology, Chinese Academy of Sciences, 32 Jiaochang Donglu Kunming, Yunnan 650223, China. E-mail: sub@mail.kiz.ac.cn (B. Su) or zhengyt@mail.kiz.ac.cn (Y.T. Zheng)

Collapse Box

Abstract

Objective: In Old World monkeys, the tripartite motif 5α (TRIM5α) protein confers resistance to HIV-1 infection following virus entry into host cells. However, the pig-tailed macaque (Macaca nemestrina) is an exception and is susceptible to HIV-1 infection. This study dissects the molecular mechanism of the pig-tailed macaque's susceptibility to HIV-1 infection.

Methods: Genomic sequencing and expression analysis of the TRIM5α gene was conducted in the pig-tailed macaque. A novel TRIM5-Cyclophilin A fusion gene isoform was identified and subsequently cloned into the pcDNA3.1(+) expression vector. This construct was transfected into HeLa-T4 or HeLa cells which were then infected with the HIV-1IIIB or HIV-GFP-VSVG pseudotyped virus, to examine the effects of the TRIM5-Cyclophilin A fusion protein on HIV-1 infection.

Results: A novel TRIM5-Cyclophilin A fusion gene (mnTRIMCyp) in the pig-tailed macaque was found and its fusion pattern is different from the known fusion gene in the owl monkey (owlTRIMCyp). TRIMCyp protein expression in transfected cells was confirmed by western blotting. The tests using HIV-1IIIB and HIV-GFP-VSVG pseudotyped virus indicated that mnTRIMCyp did not inhibit HIV-1 replication at various multiplicities of infection.

Conclusions: The mnTRIMCyp fusion protein does not restrict replication of HIV-1, which provides a potential molecular mechanism that might explain why the pig-tailed macaque is prone to HIV-1 infection, the only known exception in Old World monkeys.

Back to Top | Article Outline

Introduction

The identification of an appropriate animal model is imperative for investigating the pathogenesis, diagnostic strategies, and treatment options for HIV. The currently used rhesus macaque (Macaca mulatta) model, infected by simian immunodeficiency virus (SIV) or simian/human immunodeficiency virus (SHIV), is not ideal for these purposes [1,2]. The Chimpanzee is the closest relative to human and is susceptible to HIV-1 infection [3,4], but this species is not a suitable animal model due to their endangered status and high breeding cost. Among Old World monkeys, the pig-tailed macaque (Macaca nemestrina) has been reported to be prone to HIV-1 infection, and developing AIDS-like symptoms [5–7].

There are increasing evidences that host antiretroviral proteins are important innate barriers to retroviral infection, for example, Friend virus susceptibility 1 (Fv1) in mouse, and Apolipoprotein B mRNA editing enzyme catalytic polypeptide like 3G (APOBEC3G) and Zinc-finger antiviral protein (ZAP) in humans [8–10]. These factors act in diverse ways and at different stages of the HIV-1 life cycle. Most of them have broad antiretroviral action, including macaque simian immunodefiency virus (SIVmac), murine leukemia virus (MLV) and equine infectious anemia virus (EIAV) [8–10].

Recently it was reported that TRIM5α confers resistance to HIV-1 infection in Old World monkeys [11]. The only known exception is the pig-tailed macaque, although the mechanism behind this susceptibility remains unknown [5,7]. Among New World monkeys, the owl monkey is the only species that is not susceptible to HIV-1 infection [12]. Experiments indicated that a TRIM5-CypA fusion gene in owl monkey (owlTRIMCyp) was responsible for TRIM5α-mediated HIV-1 resistance in the owl monkey [13,14]. Here we report a novel fusion form of TRIM5-CypA in the pig-tailed macaque (mnTRIMCyp) and its function against HIV replication in vitro. Our data demonstrated that contrary to the owl monkey fusion gene owlTRIMCyp, the fusion gene mnTRIMCyp in the pig-tailed macaque failed to restrict HIV-1 infection.

Back to Top | Article Outline

Materials and methods

Cell lines and viruses

Human HeLa and HeLa-T4 cells were cultured in DMEM-10% heat-inactivated fetal bovine serum (FBS), C8166 cell lines were grown in RPMI 1640-10% heat-inactivated FBS with penicillin and streptomycin. The owl monkey OMK cell line was cultured using the conditions recommended by the American Type Culture Collection. HIV-1IIIB virus infectivity was normalized on C8166 cell line. The 50% tissue culture infectious dose (TCID50) of the HIV-1IIIB supernatants stock per milliliter was determined using the standard method [15]. Recombinant HIV-GFP-VSVG pseudotyped virus was prepared by co-transfecting 293T cells with TRIP-GFP, CMVdR8.2 and CMV-VSVG in a 1.5: 1: 1 ratio using FuGENE 6 (Roche Molecular Biochemicals, Indianapolis, Indiana, USA). Recombinant viral supernatants were harvested at 48 h post-transfection, filtered through a 0.45 μ m-pore size membrane and stored at −80°C until use.

Back to Top | Article Outline
Molecular cloning

Total RNA was extracted from pig-tailed macaque whole blood using the TRIzol method (Invitrogen, Carlsbad, California, USA), and reverse-transcribed using oligo-dT and Omniscript Reverse Transcriptase (Qiagen, Valencia, California, USA). The TRIM5α variants were amplified from cDNAs by 3′-RACE with the 3′-Full RACE Core set system (TaKaRa, Dalian, China), including the F-RACE primer (GGTACCGTCCCATCTGCCTGGAACTC) and the nested universal Primer A. Polymerase chain reaction (PCR) products were cloned into the pMD 18-T vector (TaKaRa) and confirmed by direct sequencing. All the splicing isoforms were re-amplified using nested primers, TRIM5α-F1 (5′GGCGAATTCGCCATGGCTTCTGGAATCCTGGTTAATG3′) and CypA-UTR-R (5′GGCTCTAGACTAAGCAAATGGGGTGGAGGG3′).

Back to Top | Article Outline
Vector constructs and transfection

The mnTRIMCyp variant 2 and owlTRIMCyp variant 4 cDNAs were amplified from total mRNA of the pig-tailed macaque whole blood and owl monkey OMK cells, and cloned into pMD 18-T vector (TaKaRa). The amplified mnTRIMCypV2 and owlTRIMCyp V4 cDNA plasmid and pcDNA3.1(+) plasmid were digested with EcoRI and XbaI (TaKaRa), and the digested products ligated with a rapid DNA ligation kit (Fermentas, Vilnius, Lithuania). The recombinant pcDNA3.1-mnTRIMCypV2 and owlTRIMCypV4 expression vectors were transfected into human HeLa or HeLa-T4 cell lines by Lipofectamine 2000 (Invitrogen), according to the manufacturer's instructions, and the transfected cells were selected in culture medium containing Geneticin (Invitrogen).

Back to Top | Article Outline
Drugs

Cyclosporin A (CsA, MP Biomedicals, Aurora, Ohio, USA) was dissolved in DMSO at 1 mg/ml and 2.5 μM CsA diluted in tissue culture medium was added to the cells at the time of HIV-1 infection.

Back to Top | Article Outline
Western blot analysis of fusion proteins expression

Fusion proteins of mnTRIMCypV2 and owlTRIMCypV4 stably expressed in HeLa or HeLa-T4 cells were detected by western blotting. Cells were lysed in modified radio immunoprecipitation assay (RIPA) buffer with protease inhibitors phenylmethylsulfonyl fluoride (PMSF), aprotinin and pepstatin. Whole cell lysates were separated on a 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel and electroblotted onto a Polyvinylidene fluoride (PVDF, 0.45 μm) membrane (Millipore, Billerica, Massachusetts, USA). The two proteins were detected using the anti-CypA primary antibody (Upstate, Lake Placid, New York, USA) followed by a horseradish peroxidase (HRP)-conjugated secondary antibody (Sigma, Saint Louis, Missouri, USA) and illuminated with electrochemoluminescent reagent (Cell Signaling, Lake Placid, New York, USA).

Back to Top | Article Outline
Restriction of HIV-1 infection assays

HeLa-T4 cells were seeded in 24-well plates at 2 × 104 cells per well and incubated at 37°C, 5% CO2 overnight. The transfected cells were infected with the HIV-1IIIB strain at different multiplicity of infection (M.O.I = 0.5, 1, 5, 10) in 1 ml culture medium and incubated for 2 h. When CsA was used, it was added at the same time as the virus. The HIV-1-infected cells were then washed twice with phosphate-buffered saline (PBS) and incubated at 37°C, 5% CO2 in 1 ml of fresh culture medium. A total of 200 μl of supernatant from HIV-1-infected cultures was collected at different time-points and lysed by 0.5 % Triton X-100. The HIV-1 p24 antigen was measured by enzyme-linked immunosorbent assay (ELISA) assay as previously described [16]. HeLa cells seeded in 24-well plates at a density of 3 × 104 cells/well were incubated in the presence of three-fold serially diluted virus and 8 μg/ml polybrene for 4 h. Cells were washed twice with PBS, fresh culture medium was added and cultured for 48 h, then the percentage of GFP-positive cells well counted by fluorescence activated cell sorter analysis using a FACSCalibur (Becton Dickinson, San Jose, California, USA).

Back to Top | Article Outline
Accession numbers

The primate TRIM5-CypA sequences have been deposited in the GenBank database under accession numbers DQ 308404 to DQ 308406.

Back to Top | Article Outline

Results

Retrotransposition of CypA into the pig-tailed macaque TRIM5α locus

Whilst attempting to sequence the TRIM5α gene of the pig-tailed macaque, we identified a PCR product containing a cDNA copy of CypA gene. Sequence analysis indicated that the CypA cDNA copy is retrotransposed into the 3′ regulatory region of TRIM5α (Fig. 1a), resulting in a fusion gene. The novel fusion gene was designated as mnTRIMCyp (Macaca nemestrina TRIM5α-CypA). Three pig-tailed macaque samples were sequenced and all were homozygous for the observed retrotransposition.

Fig. 1
Fig. 1
Image Tools
Fig. 1
Fig. 1
Image Tools

Interestingly, the fusion pattern of TRIM5α and CypA in the pig-tailed macaque is different from that of the owl monkey (Fig. 1b; [13,14]). We sequenced four other macaque species and no retrotransposition was observed [17]. Hence, the retrotransposition of CypA into TRIM5α in the pig-tailed macaque is a recent and independent event.

Back to Top | Article Outline
Analysis of TRIM5-CypA fusion transcripts

We then sought to understand the expression pattern of the putative fusion gene. We designed primers to amplify mnTRIMCyp from mRNA and investigated the expression of this gene in the peripheral blood mononuclear cells (PBMC) of three unrelated adult pig-tailed macaques. Our results indicate that there are three splicing forms encoded by the putative fusion gene (Fig. 1b). Among them, the V1 and V2 forms are the dominant forms (54%, 20/37 and 43%, 16/37, respectively, estimated by the relative abundance of clones). Both V1 and V2 are fusion transcripts of TRIM5α and CypA. The V1 form encodes 260 amino acids (aa) containing the 5′ coding region of TRIM5α (exon 2-4, 250 aa) and the 5′ untranslated region of CypA (10 aa). The V2 form encodes a fusion protein of 468 aa including 291 aa from exon 2-6 of TRIM5α and 177 aa from CypA (12 aa from the 5′ untranslated region and 165 aa of the complete coding region). Exons 7 and 8 of TRIM5α were not transcribed in the V1 and V2 fusion forms. Therefore, these two isoforms do not contain the SPRY domain of TRIM5α, which has been reported as the crucial region for resistance to HIV-1 infection in Old World monkeys [18,19]. Next, we used primers designed to amplify mRNA corresponding to exon 8 of TRIM5α to investigate whether the pig-tailed macaque expresses the intact gene as well as the putative mnTRIMCyp fusion gene. We could not detect intact TRIM5α. However, we can not rule out the possibility that splicing forms with low expression abundance might still exist.

Back to Top | Article Outline
mnTRIMCyp restriction of HIV-1

The V2 splicing isoform of mnTRIMCyp that we have detected in the pig-tailed macaque is similar to a fusion gene described in the owl monkey, which showed restrictive effects on HIV-1 infection [13,14]. The putative amino acid sequence of the retrotransposed CypA copy in the V2 form of pig-tailed macaque is highly conserved when compared with the human CypA protein (162/165 = 98.2%). To investigate whether the mnTRIMCyp V2 protein has any effect on the susceptibility of HIV-1 infection, a functional assay was designed to test the ability of mnTRIMCyp V2 to inhibit HIV-1 infection.

Expression constructs were produced by inserting mnTRIMCyp V2 and owlTRIMCyp V4 into pcDNA3.1 (+). These constructs, as well as pcDNA3.1(+) alone, were transfected into HeLa-T4 cells, and transfected cells were selected using media containing Geneticin. All transfected cell lines were then infected with HIV-1IIIB. Western blotting confirmed the expression of the mnTRIMCyp V2 and owlTRIMCyp V4 proteins in transfected cells. (Fig. 2).

Fig. 2
Fig. 2
Image Tools

The effects of these constructs on HIV-1 infection were examined by measuring the HIV-1 p24 antigen via ELISA. Our results demonstrate that mnTRIMCyp does not inhibit HIV-1 replication after virus entry into the cells at various M.O.I (Fig. 3a), whereas the cell lines transfected with the owl monkey fusion gene show strong restrictive effects at low M.O.I (0.5 and 1.0), consistent with the previous reports [13,14]. However, when the M.O.I of HIV-1 is elevated to 5 and 10, the restrictive effect of the owl monkey fusion gene is greatly decreased, probably due to a saturation effect. It should be noted that in our experiments, the restrictive effect of the owl monkey fusion gene is not as strong as previously reported [13,14].

Fig. 3
Fig. 3
Image Tools

To confirm the effect of mnTRIMCyp, we investigated the response of the fusion gene activity to Cyclosporin A (CsA), a drug that disrupts the interaction between the HIV-1 capsid and CypA. CsA treatment of cells expressing mnTRIMCyp inhibited HIV-1 infection (data not shown), consistent with previous reports [20,21]. However, in the owl monkey, the opposite effect was reported, with CsA treatment increasing the infection by HIV-1 [13,14].

Next we investigated the effect of mnTRIMCyp on the infectivity of HIV-GFP-VSVG pseudotyped virus. The mnTRIMCyp and owlTRIMCyp constructs, as well as pcDNA3.1(+) alone, were transfected into human HeLa cells and selected in the media containing Geneticin, Cells stably expressing the fusion proteins were detected by immunoblot (Fig. 2). The ability of these constructs to restrict HIV-GFP-VSVG pseudotyped virus infection was quantified by comparing the percentage of infected HeLa cells. Our results demonstrated that owlTRIMCyp clearly inhibited HIV-1, as shown by a three to four-fold reduction in infection in owlTRIMCyp-transfected HeLa cells compared with empty pcDNA3.1 (+) transfected HeLa cells (Fig. 3b). But no difference was observed between the infection of the mnTRIMCyp and empty pcDNA3.1(+) transfected HeLa cells.

The effects of mnTRIMCyp on pseudotyped virus infection were in accordance to p24 core antigen ELISA assay in HIV-1IIIB infection. Again, mnTRIMCyp does not restrict the replication of HIV-GFP-VSVG, but owlTRIMCyp does.

Back to Top | Article Outline

Discussion

In Old World monkeys, it has been reported that the restriction of HIV-1 infection was mainly due to the sequence divergence of TRIM5α when compared with humans and apes [17,18]. The RING domain of TRIM5α is not necessarily required for retroviral restriction but can affect the expression level of the gene. The B-Box2 and SPRY domains are essential for efficient retroviral resistance [19,22,23], and a single amino acid site in the SPRY domain was reported to be responsible for the restricting HIV-1 infection in Old World monkeys [19].

CypA interacts with the capsid of HIV-1 and is known to be involved in HIV-1 infection [24–27]. In the human genome, more than 60 processed CypA pseudogenes have been reported across the genome by retrotransposition [28]. We observed a similar pattern in chimpanzees by genome-wide sequence analysis (data not shown), implying that CypA retrotransposition is a common phenomenon during primate evolution.

Recently, a fusion protein (TRIMCyp) was reported in owl monkey, a New World monkey species [13,14]. The fusion was also caused by retrotransposition of CypA into TRIM5α, and the fusion gene conferred strong post-entry restriction of HIV-1 infection in owl monkey. It has been shown that in Old World monkey cells, CypA is required for TRIM5α-mediated resistance to HIV-1 [29]. Our data suggests that the CypA copy in the pig-tailed macaque fusion gene might not have the correct conformation to interact with the HIV-1 capsid, which calls for further CA- mnTRIMCyp interaction studies. Another major mnTRIMCyp isoform in the pig-tailed macaque is the V1 form, which encodes a truncated protein of CypA and has completely lost the SPRY domain of TRIM5α. Therefore, this isoform may not have any restrictive effects on HIV-1 infection either [30,31].

The different effects of the two fusion genes on HIV-1 infection in pig-tailed macaque and owl monkey are intriguing. In the case of owl monkey, it was suggested that although the fusion gene TRIMCyp has lost the SPRY domain, the retrotransposed CypA supplemented the function of the SPRY domain of TRIM5α, enabling the fusion protein to interact with the capsid proteins of HIV-1, resulting in resistance to infection [13,14]. However, our data on the pig-tailed macaque suggests that the nmTRIMCyp fusion protein has no restrictive activity on HIV-1 infection. It is likely that the cells of pig-tailed macaque differ from those of other Old World monkeys in allowing HIV-1 infection to reach the stage of reverse transcription. The comparison of putative amino acid sequences of the owl monkey V4 and the pig-tailed macaque of Guest TRIMCyp fusion protein are shown in Fig. 1c.

The fusion gene in pig-tailed macaque is defective in defending against HIV-1 infection, which raises a question of what its evolutionary function may be. There are several possible explanations. First, the fusion gene might have other potential benefits for pig-tailed macaques; for example it might be resistant to infection of other viruses. Second, the fixation of the mnTRIMCyp fusion gene may be due to genetic drift.

The narrow host range of HIV-1 has impeded the development of a suitable animal model for the study of AIDS pathogenesis and evaluation of therapeutic drugs and vaccine strategies. Although other New World monkeys are also susceptible to HIV-1 infection, they do not manifest the symptoms. Furthermore, in the phylogeny of primate evolution, the relationship between New World monkey and human is further than Old World monkey with human. Hence, the pig-tailed macaque, as the only known Old World monkey species prone to HIV-1 infection, may serve as a potential animal model for HIV-1 studies. Recently, the pig-tailed macaque AIDS models have been explored by Pullium and Otten et al. using HIV-1 virus [32,33]. Their studies demonstrated that pig-tailed macaque is a very promising AIDS non-human primate in the pathogenesis and prophylactic methodology.

In conclusion, a novel TRIM5-Cyclophilin A fusion gene (mnTRIMCyp) in the pig-tailed macaque was found and its fusion pattern is different from the owlTRIMCyp [13]. It provides a potential molecular mechanism that could explain why the pig-tailed macaque is susceptible to HIV-1 infection. The fusion of TRIM5a and CypA disrupts the open reading frame of TRIM5α, resulting in a chimeric protein that has lost the ability to restrict HIV-1 restriction in pig-tailed macaque. Our study confirms that the pig-tailed macaque might be an optimal AIDS animal model which allows investigators dissecting the mechanism of HIV infection and disease development during the early stage of HIV-1 infection.

Back to Top | Article Outline

Acknowledgements

The authors are grateful to the technical help of Xiao-Na Fan and Yi-Chuan Yu and Professor Ye Yan for providing samples of pig-tailed macaques. We thank Dr Guangxia Gao (Institute of Biophysics, CAS) for providing HIV-GFP-VSVG pseudotyped virus expression plasmids and Prof. Wei-Ming Xu (Institute of Medical Biology, CAMS/PUMC) for providing plasmids. We also acknowledge Dr Danielle Dye for critical and constructive comments on the manuscript.

Sponsorship: This work was supported in part by grants from the CAS (KSCX1-YW-R-34, KSCX1-YW-R-15), the NSFC (30630013, 30525028, 30440018, 30471605, 30671960), 973 program (2006CB701506, 2006CB504200, 2006CB504300, 2007CB815705), Key Technology R & D program of China (2004BA719A14), and Yunnan (2004NG12).

Back to Top | Article Outline

References

1. Chakrabarti L, Guyader M, Alizon M, Daniel MD, Desrosiers RC, Tiollais P, et al. Sequence of simian immunodeficiency virus from macaque and its relationship to other human and simian retroviruses. Nature 1987; 28:543–547.

2. Franchini G, Bosch ML. Genetic relatedness of the human immunodeficiency viruses type 1 and 2 (HIV-1, HIV-2) and the simian immunodeficiency virus (SIV). Ann N Y Acad Sci 1989; 554:81–87.

3. Fultz PN, McClure HM, Swenson RB, McGrath CR, Brodie A, Getchell JP, et al. Persistent infection of chimpanzees with human T-lymphotropic virus type III/lymphadenopathy-associated virus: a potential model for acquired immunodeficiency syndrome. J Virol 1986; 58:116–124.

4. Lusso P, Markham PD, Ranki A, Earl P, Moss B, Dorner F, et al. Cell-mediated immune response toward viral envelope and core antigens in gibbon apes (Hylobates lar) chronically infected with human immunodeficiency virus-1. J Immunol 1988; 141:2467–2473.

5. Agy MB, Frumkin LR, Corey L, Coombs RW, Wolinsky SM, Koehler J, et al. Infection of Macaca nemestrina by human immunodeficiency virus type-1. Science 1992; 257:103–106.

6. Kent SJ, Corey L, Agy MB, Morton WR, McElrath MJ, Greenberg PD. Cytotoxic and proliferative T cell responses in HIV-1-infected Macaca nemestrina. J Clin Invest 1995; 95:248–256.

7. Pekrun K, Shibata R, Igarashi T, Reed M, Sheppard L, Patten PA, et al. Evolution of a human immunodeficiency virus type 1 variant with enhanced replication in pig-tailed macaque cells by DNA shuffling. J Virol 2002; 76:2924–2935.

8. Gao G, Guo X, Goff SP. Inhibition of retroviral RNA production by ZAP, a CCCH-type zinc finger protein. Science 2002; 297:1703–1706.

9. Hatziioannou T, Cowan S, Goff SP, Bieniasz PD, Towers GJ. Restriction of multiple divergent retroviruses by Lv1 and Ref1. EMBO J 2003; 22:385–394.

10. Sheehy AM, Gaddis NC, Choi JD, Malim MH. Isolation of a human gene that inhibits HIV-1 infection and is suppressed by the viral Vif protein. Nature 2002; 418:646–650.

11. Stremlau M, Owens CM, Perron MJ, Kiessling M, Autissier P, Sodroski J. The cytoplasmic body component TRIM5alpha restricts HIV-1 infection in Old World monkeys. Nature 2004; 427:848–853.

12. Hofmann W, Schubert D, LaBonte J, Munson L, Gibson S, Scammell J, et al. Species-specific, postentry barriers to primate immunodeficiency virus infection. J Virol 1999; 73:10020–10028.

13. Nisole S, Lynch C, Stoye JP, Yap MW. A TRIM5-cyclophilin A fusion protein found in owl monkey kidney cells can restrict HIV-1. Proc Natl Acad Sci U S A 2004; 101:13324–13328.

14. Sayah DM, Sokolskaja E, Berthoux L, Luban J. Cyclophilin A retrotransposition into TRIM5 explains owl monkey resistance to HIV-1. Nature 2004; 430:569–573.

15. Johnson VA, Byington RE. Infectivity assays (virus field assay). In: Aldovini A, Walker BD, editors. Techniques in HIV research. New York: Stockton Press; 1990. pp. 71–76.

16. Ouyang DY, Chan H, Wang YY, Huang H, Tam SC, Zheng YT. An inhibitor of c-Jun N-terminal kinases (CEP-11004) counteracts the anti-HIV-1 action of trichosanthin. Biochem Biophys Res Commun 2006; 339:25–29.

17. Liu HL, Wang YQ, Liao CH, Kuang YQ, Zheng YT, Su B. Adaptive evolution of primate TRIM5alpha, a gene restricting HIV-1 infection. Gene 2005; 362 C:109–116.

18. Sawyer SL, Wu LI, Emerman M, Malik HS. Positive selection of primate TRIM5alpha identifies a critical species-specific retroviral restriction domain. Proc Natl Acad Sci U S A 2005; 102:2832–2837.

19. Yap MW, Nisole S, Stoye JP. A single amino acid change in the SPRY domain of human TRIM5alpha leads to HIV-1 restriction. Curr Biol 2005; 15:73–78.

20. Franke EK, Luban J. Inhibition of HIV-1 replication by cyclosporine A or related compounds correlates with the ability to disrupt the Gag-cyclophilin A interaction. Virology 1996; 222:279–282.

21. Karpas A, Lowdell M, Jacobson SK, Hill F. Inhibition of human immunodeficiency virus and growth of infected T cells by the immunosuppressive drugs cyclosporin A and FK 506. Proc Natl Acad Sci U S A 1992; 89:8351–8355.

22. Javanbakht H, Diaz-Griffero F, Stremlau M, Si Z, Sodroski J. The contribution of RING and B-box 2 domains to retroviral restriction mediated by monkey TRIM5alpha. J Biol Chem 2005; 280:26933–26940.

23. Perez-Caballero D, Hatziioannou T, Zhang F, Cowan S, Bieniasz PD. Restriction of human immunodeficiency virus type 1 by TRIM-CypA occurs with rapid kinetics and independently of cytoplasmic bodies, ubiquitin, and proteasome activity. J Virol 2005; 79:15567–15572.

24. Franke EK, Yuan HE, Luban J. Specific incorporation of cyclophilin A into HIV-1 virions. Nature 1994; 372:359–362.

25. Hatziioannou T, Perez-Caballero D, Cowan S, Bieniasz PD. Cyclophilin interactions with incoming human immunodeficiency virus type 1 capsids with opposing effects on infectivity in human cells. J Virol 2005; 79:176–183.

26. Thali M, Bukovsky A, Kondo E, Rosenwirth B, Walsh CT, Sodroski J, et al. Functional association of cyclophilin A with HIV-1 virions. Nature 1994; 372:363–365.

27. Towers GJ, Hatziioannou T, Cowan S, Goff SP, Luban J, Bieniasz PD. Cyclophilin A modulates the sensitivity of HIV-1 to host restriction factors. Nat Med 2003; 9:1138–1143.

28. Zhang Z, Harrison PM, Liu Y, Gerstein M. Millions of years of evolution preserved: a comprehensive catalog of the processed pseudogenes in the human genome. Genome Res 2003; 13:2541–2558.

29. Berthoux L, Sebastian S, Sokolskaja E, Luban J. Cyclophilin A is required for TRIM5{alpha}-mediated resistance to HIV-1 in Old World monkey cells. Proc Natl Acad Sci U S A 2005; 102:14849–14853.

30. Gamble TR, Vajdos FF, Yoo S, Worthylake DK, Houseweart M, Sundquist WI, et al. Crystal structure of human cyclophilin A bound to the amino-terminal domain of HIV-1 capsid. Cell 1996; 87:1285–1294.

31. Kootstra NA, Munk C, Tonnu N, Landau NR, Verma IM. Abrogation of postentry restriction of HIV-1-based lentiviral vector transduction in simian cells. Proc Natl Acad Sci U S A 2003; 100:1298–1303.

32. Otten RA, Smith DK, Adams DR, Pullium JK, Jackson E, Kim CN, et al. Efficacy of postexposure prophylaxis after intravaginal exposure of pig-tailed macaques to a human-derived retrovirus (Human Immunodeficiency Virus Type 2). J Virol 2000; 74:9771–9775.

33. Pullium JK, Adams DR, Jackson E, Kim CN, Smith DK, Janssen R, et al. Pig-tailed macaques infected with human immunodeficiency virus (HIV) type 2GB122 or simian/HIV89.6p express virus in semen during primary infection: new model for genital tract shedding and transmission. J Infect Dis 2001; 183:1023–1030.

Keywords:

TRIM5α; Cyclophilin A; fusion gene; HIV-1 restriction factor; pig-tailed macaque

© 2007 Lippincott Williams & Wilkins, Inc.

Login

Search for Similar Articles
You may search for similar articles that contain these same keywords or you may modify the keyword list to augment your search.