Skip Navigation LinksHome > October 1, 2007 - Volume 21 - Issue 15 > The presence of the Trim5α escape mutation H87Q in the capsi...
AIDS:
doi: 10.1097/QAD.0b013e3282effa87
Basic Science

The presence of the Trim5α escape mutation H87Q in the capsid of late stage HIV-1 variants is preceded by a prolonged asymptomatic infection phase

Kootstra, Neeltje A; Navis, Marjon; Beugeling, Corrine; van Dort, Karel A; Schuitemaker, Hanneke

Free Access
Article Outline
Collapse Box

Author Information

From the Department of Clinical Viro Immunology, Sanquin Research, Landsteiner Laboratory, and Center of Infection and Immunity Amsterdam (CINIMA), University of Amsterdam, Plesmanlaan 125, 1066 CX Amsterdam, The Netherlands.

Received 16 May, 2007

Revised 3 July, 2007

Accepted 10 July, 2007

Correspondence to NA Kootstra, Department of Clinical Viro Immunology, Sanquin Research, Plesmanlaan 125, 1066 CX Amsterdam, The Netherlands. Tel: +31 20 12 3317; fax: +31 20 512 3310; e-mail: N.Kootstra@sanquin.nl

Collapse Box

Abstract

Background: Recently, the tripartite interaction motif 5α (Trim5α) has been identified as an inhibitory factor blocking infection of a broad range of retroviruses in a species-specific manner. In particular, HIV-1 replication can be efficiently blocked by Trim5α from Old World monkeys. The cyclophilin A binding region in the HIV-1 capsid is believed to be the viral determinant for Trim5α, and mutations in this region lift the restriction in simian cells. Human Trim5α is also able to inhibit HIV-1 replication in vitro, implying that Trim5α may contribute to host control of HIV-1 replication in vivo.

Methods: HIV-1 variants from participants of the Amsterdam cohort studies were analysed for Trim5α escape mutations in the capsid. Patients who harboured HIV-1 variants with Trim5α escape mutations were compared with patients who lacked such variants in terms of clinical course of infection.

Results: Trim5α escape mutants emerged in the late phase of infection and were ultimately present in 13.7% of HIV-1 infected individuals. Patients who developed Trim5α escape variants late in infection had a significantly lower set-point plasma viral RNA load and concomitantly a prolonged asymptomatic survival as compared to individuals who lacked Trim5α escape mutants. This protective effect was stronger in individuals who later developed X4 variants. In addition, X4-emergence was delayed in individuals who later developed Trim5α escape variants, compatible with suppression of viral replication.

Conclusion: Our data are compatible with Trim5α-mediated suppression of viral replication, resulting in prolonged asymptomatic survival and ultimately the selection of Trim5α escape variants.

Back to Top | Article Outline

Introduction

The clinical course of HIV-1 infection in humans is characterized by a gradual loss of CD4 T cells [1] and increasing T cell dysfunction [2,3], eventually resulting in the development of AIDS. Although viraemia is controlled during the asymptomatic phase, high level virus replication has been shown throughout infection [4,5]. Due to persistent virus replication and the error-prone nature of HIV-1 reverse transcriptase [6,7], the mutation rate of the viral genome is extremely high. The continuous emergence of mutant HIV-1 variants will facilitate escape from the immune system, development of resistance to antiretroviral therapy, and selection for beneficial biological properties such as coreceptor use and replicative capacity. Consequently, there is an ongoing evolution and high diversity of the viral quasispecies throughout infection.

Many species exhibit an antiviral activity that blocks retroviral infection at an early step in the viral replication cycle [8–13]. Recently, the tripartite interaction motif 5α (Trim5α) was identified as an inhibitory factor that protects human and non-human primates against retroviruses [14,15]. Trim5 is a member of the tripartite motif family and encodes five known isoforms that all contain a RING, B-box 2 and coiled-coiled domain [16]. Trim5α is the only isoform known to restrict retroviral replication and contains an additional C-terminal B30.2 or SPRY domain. The B30.2 and the coiled-coiled domain are involved in recognition of the viral capsid and are essential for the restriction activity of the protein [17–24].

Species-specific variations in Trim5α of different primates account for the restriction pattern of particular retroviruses [25–31]. For example, HIV-1 replication is blocked efficiently by Trim5α of rhesus macaques and African green monkeys, whereas SIVmac is restricted only by Trim5α from African green monkey cells. Human Trim5α efficiently blocks N-tropic murine leukaemia virus and equine infectious anaemia virus, but is much less efficient in restricting HIV-1 replication. This indicates that HIV-1 has at least partially adapted to the human variant of this restriction factor. Although inhibition of HIV-1 replication by human Trim5α has been observed in vitro [14,32–34], it remains unclear whether Trim5α contributes to host control of HIV-1 replication during the natural course of infection.

Recently we and others have demonstrated that the viral determinant in Trim5α mediated inhibition is located in the cyclophilin A (CyPA) binding region of the HIV-1 capsid and that mutations in this region resulted in resistance to this restriction [17,35–39]. Interestingly, we and others have demonstrated that CyPA, which specifically interacts with HIV-1 capsid [40–44], is required for Trim5α mediated restriction of HIV-1 in Old World monkey cells [34,39,45–47]. In contrast, CyPA supports HIV-1 infection in human cells by protecting HIV-1 from antiviral factors such as Trim5α [34,35,46,48–50]. Mutations in the CyPA binding region associated with CyPA independent replication also resulted in escape from inhibition by human Trim5α [35–37,39]. Interestingly, naturally occurring HIV-1 variants with mutations in the CyPA binding region associated with escape from Trim5α have recently been described [35,51].

Here we studied whether Trim5α escape variants of HIV-1 emerge during the course of infection. In addition, we analysed whether the clinical course of infection differed between individuals who developed Trim5α escape variants and those who did not.

Back to Top | Article Outline

Methods

Study population

The study population consisted of Caucasian homosexual men enrolled in the Amsterdam cohort studies (ACS) on the natural history of HIV-1 infection between October 1984 and February 1988. Of 364 participants, we selected 161 individuals with documented AIDS diagnosis or follow-up of at least 7 years without an AIDS diagnosis, and from whom cryopreserved peripheral blood mononuclear cells (PBMC) late in infection were available. Of this group, 96 individuals were seropositive at the time of entry into the ACS, while 65 individuals seroconverted during follow-up. Previous epidemiological studies on the incidence of HIV-1 infection amongst homosexual participants of the ACS have shown that infection in seroprevalent men occurred on average 1.5 years before entry into the ACS [52,53], therefore seroconversion of the seroprevalent group was set at 1.5 years before entry. Individuals did not receive HAART during the study period (censor date 1 January 1996), and developed AIDS (n = 136; definition 1987 or 1993) before the censor date or had an asymptomatic follow-up of at least 7 years. ACS participants were routinely tested for the presence of CXCR4-using variants (X4-variants). Characteristics of the study population are summarized in Table 1.

Table 1
Table 1
Image Tools

Longitudinally obtained clonal HIV-1 variants from 30 ACS participants were analysed for mutations in the CyPA binding region of capsid. Of 131 ACS participants, screening for the H87Q mutation in capsid was performed on viruses isolated relatively late in the course of infection, from 1 year before AIDS diagnosis or later. In individuals who developed X4-variants, viruses were isolated at least 1 year after the first detection of X4-variants. From individuals who did not develop X4-variants and who did not reach an endpoint during follow-up, viruses were isolated at least 7 years after seroconversion.

The ACS has been conducted in accordance with the ethical principles set out in the declaration of Helsinki and written informed consent was obtained prior to data collection. The study was approved by the Amsterdam Medical Center institutional medical ethics committee.

Back to Top | Article Outline
DNA isolation and sequencing

Clonal HIV-1 variants or bulk isolates were obtained as described previously [54]. Total DNA was isolated from HIV-1 infected cell cultures. The CyPA binding region of capsid was amplified by PCR using primer pair p24-5E (5′–CAGCAATCAGGTCAGCCAAAATTAC–3′) and p24-3E (5′–GTTACTTGGCTCATTGCTTCAGCCA–3′) in the primary reaction and primer pair p17-F (5′–TGCTAAACACAGTGGGGGGACATC–3′) and p17-R (5′–CAGCCAAAACTCTTGCCTTATGG–3′) in the nested reaction. PCR products were sequenced with the ABI prism BigDye Terminator kit V1.1 (Applied Biosystems) using primers p17-F and p17-R. Sequences were analysed on an ABI 3130XL Genetic Analyzer.

Back to Top | Article Outline
HIV-1 based lentiviral vector production and infection

The green fluorescent protein expressing HIV-1 based lentiviral vector was described previously [55]. The mutant lentiviral vector containing a glutamine at position 87 and a valine at position 91 of capsid was created by a site directed mutagenesis (Stratagene, La Jolla California, USA) of the packaging construct. Lentiviral vectors were produced as previously described [55]. To determine the infectious titer, 293T cells were plated at a density of 1 × 104 cells per well, and were transduced with serial dilutions of the vector. Four days after inoculation, transduction efficiency was analysed by fluorescence-activated cell sorter.

TE671-Luc-shRNA and TE671-TR5-shRNA cells, a kind gift of J. Luban and E. Sokolskaja [34], were cultured in Dulbecco's modified Eagle's medium supplemented with 10% foetal bovine serum (Hyclone, Logan, Utah, USA), antibiotic/antimycotic (Life Technologies, Rockville, Maryland, USA). Cells were plated at a density of 1 × 104 per well and were inoculated with different amounts of LV after 24 h. Infected cells were quantified by fluorescence-activated cell sorter analysis 5–6 days after inoculation.

Back to Top | Article Outline
Statistical analysis

For statistical analysis we assumed that the presence of Trim5α escape mutations in virus variants isolated at a late stage in infection is indicative for the presence of Trim5α selection pressure during the preceding period of infection. Hence the presence of escape mutations was treated as baseline time-fixed covariate. Kaplan–Meier and Cox proportional hazard analysis were performed to study the relationship between development of Trim5α escape variants and disease progression. Endpoints that were used for analysis were AIDS according to the 1987 Centers for Disease Control and Prevention definition, CD4 T cell counts < 200 cells/μl blood, and first detection of X4-variants [56]. We performed this analysis in the total group (n = 161), participants who did not develop detectable X4-variants (R5-only), and the group of X4-patients. To allow this analysis, we assumed that individuals who developed X4-variants are different from R5-only individuals already before the appearance of X4-variants and thus development of X4-variants during follow-up was treated as a baseline time-fixed covariate. Univariate and multivariate relative hazards were calculated at 2 years after seroconversion for CD4 T cells at 18–30 months after seroconversion, viral RNA load at 18–30 months after seroconversion, the CCR5 genotype and development of Trim5α escape variants. Bivariate relative hazards were calculated at seroconversion for CCR5 genotype and development Trim5α escape variants.

Fisher's exact test was used to analyse an association between the H87Q mutation in capsid and development of X4-variants, R136Q polymorphism in Trim5α, and other mutations at position 91 and 96 of the CyPA binding region of the viral capsid. Mann–Whitney U test was used to analyse statistical differences in CD4 T cell count and viral RNA load between patients who did or did not develop Trim5α escape variants. Paired samples t test was used to compare the ability of lentiviral vectors to infect TE671-Luc-shRNA and TE671-TR5-shRNA cells. All analyses were performed using SPSS (release 13.0, SPSS Inc., Chicago, Illinois, USA).

Back to Top | Article Outline

Results

HIV-1 variants with the H87Q mutation in the CyPA binding region develop during the course of HIV-1 infection and are resistant to Trim5α mediated inhibition

First we analysed if HIV-1 variants with Trim5α escape mutations in the CyPA binding region of the capsid protein developed during the natural course of infection. Clonal HIV-1 variants isolated from PBMC collected at different time points during HIV-positive follow-up in the ACS from 30 individuals were analysed for mutations in the CyPA binding region of capsid. The H87Q substitution was the only change observed that has previously been associated with resistance to Trim5α [17,35–39]. Mutant viruses appeared in the late phase of infection in seven of 30 HIV-1 infected individuals, and ultimately became the dominant virus population (data not shown). Table 2 shows the sequence analysis of the CyPA binding region in longitudinally obtained HIV-1 variants from two representative cohort participants. In participant ACH19510 HIV-1 variants with the H87Q mutation appeared as a minor population 92 months after seroconversion, which was 14 months after the first detection of CXCR4-using variants (X4-variants) and 9 months before AIDS diagnosis (Table 2). Six months later, all virus variants had the H87Q mutation. In participant ACH19829, H87Q mutants were first detected 51 months after seroconversion which was 12 months before the emergence of X4-variants and 32 months before AIDS diagnosis (Table 2). In this patient co-existing wild-type HIV-1 variants could be detected at all subsequent time points.

Table 2
Table 2
Image Tools

To verify that the H87Q mutation in the CyPA binding region was indeed associated with escape from Trim5α, the mutation was introduced into the HIV-1 based lentiviral vector. TE671 cells knocked down for Trim5 using shRNA (TE671-TR5-shRNA) and control cells (TE671-Luc-shRNA) (a kind gift of J. Luban and E. Sokolskaja [34]) were infected with wild-type or mutant lentiviral vector. Knock-down of Trim5α significantly enhanced infection by the wild-type lentiviral vector (P = 0.002), whereas the infectivity of the mutant lentiviral vector was the same as in control cells indicating that the H87Q mutation was indeed associated with resistance to Trim5α mediated inhibition (Fig. 1).

Fig. 1
Fig. 1
Image Tools
Back to Top | Article Outline
Development of Trim5α escape variants late in infection is preceded by a prolonged asymptomatic phase

To analyse whether the development of Trim5α escape variants correlated with the clinical course of infection, we screened an additional 131 participants of the ACS for the presence of viruses with the H87Q mutation. HIV-1 was isolated relatively late in infection (>1 year after development of X4-variants, 1 year before AIDS diagnosis or later, or after a follow-up of at least 7 years in individuals who lacked X4-variants or a clinical endpoint). Virus variants with the Trim5α escape mutation were observed in 22 individuals (13.7%). The prevalence of Trim5α escape mutations was not significantly different between individuals who did or did not develop X4-variants in the course of infection (18.7% versus 9.3% in X4- and R5-only patients, respectively; P = 0.108). Furthermore, there was no significant difference in time of sampling between patient groups that did or did not harbour viruses with the H87Q mutation.

Next, we performed Kaplan–Meier and Cox Proportional Hazard analyses on groups of patients that did or did not develop Trim5α resistance mutations, using clinical AIDS as an endpoint (definition 1987). This analysis showed a significant delay in disease progression of the group that ultimately developed Trim5α escape variants [log rank, P = 0.034; relative hazard (RH), 0.418; 95% confidence interval (CI), 0.182–0.959; P = 0.040; Fig. 2a). In agreement, a significant difference was observed in the viral RNA load at 18 months after seroconversion between individuals who did or did not develop viruses with the H87Q mutation (3.9 ± 0.8 versus 4.4 ± 0.7 log viral RNA/ml plasma respectively, P = 0.017).

Fig. 2
Fig. 2
Image Tools

Next, we studied whether the association between Trim5α and the clinical course of infection was independent of the development of X4-variants in the course of infection. To this end, we performed Kaplan–Meier and Cox proportional hazard analyses with clinical AIDS as an endpoint for individuals who did or did not develop Trim5α escape variants separately for individuals who did or did not develop X4-variants in their course of infection. For X4-patients (n = 75) a delay in disease progression rate was observed in individuals who developed Trim5α escape variants late in infection (log rank, P = 0.029; RH, 0.292 95% CI, 0.090–0.949; P = 0.041; Fig. 2a). However, no difference in the clinical course was observed in R5-only patients that did or did not develop Trim5α escape variants late in infection (n = 86) (Fig. 2a). Individuals who late in infection developed X4-variants and Trim5α escape variants had slower CD4 declines in the preceding asymptomatic phase of infection as compared to X4-patients who did not develop Trim5α escape variants (log rank, P = 0.059; RH, 0.493; 95% CI, 0.233–1.043, P = 0.064; Fig. 2b). Finally, a statistically significant delayed time to first X4-variant emergence was observed in individuals who developed Trim5α escape variants late in infection (log rank, P = 0.031; RH, 0.481; 95% CI, 0.244–0.947; P = 0.034; Fig. 2c).

As evolution to X4-variants requires the accumulation of mutations and therefore active virus replication, the delayed emergence of X4-variants in individuals preceding the development of Trim5α escape variants is compatible with Trim5α mediated suppression of viral replication in the early phase of infection. Indeed, as what was seen for the total patient group, X4-patients who developed viruses with the H87Q mutation late in infection had a significantly lower viral RNA load in plasma at 18 months after seroconversion than X4-patients without Trim5α escape variants (3.9 ± 0.8 versus 4.6 ± 0.7 log viral RNA/ml plasma respectively; P = 0.020).

Univariate and multivariate relative hazard analysis was used to determine the association between progression to AIDS and the development of Trim5α escape variants, the CCR5-genotype, CD4 T cell counts and plasma viral RNA load. Univariate analysis at 2 years after seroconversion indicated that all markers analysed here were predictive for a delayed disease progression (Table 3). Multivariate analysis at 2 years after seroconversion implicated only viral RNA load < 104.5 copies/ml plasma as an independent predictor for delayed disease progression (Table 3). At seroconversion, bivariate analysis revealed that the emergence of Trim5α escape variants ever in the course of infection was associated with prolonged AIDS free survival even after adjustment for CCR5-genotype (univariate: RH, 0.42; 95% CI, 0.18–0.97; P = 0.42; bivariate: RH, 0.50; 95% CI, 0.26–0.94; P = 0.030) (Table 3).

Table 3
Table 3
Image Tools
Back to Top | Article Outline

Discussion

Human Trim5α is able to block HIV-1 replication albeit less efficiently than rhesus macaque Trim5α [14,26,27,30,32–34]. This suggests that the role of Trim5α in host control of virus burden during the asymptomatic phase of HIV-1 infection might be limited. Previous studies have demonstrated, however, that even a threefold decrease in viral RNA load in vivo significantly delayed disease progression for more than 2 years [57]. This indicates that even a limited inhibition of HIV-1 replication by Trim5α might influence HIV-1 pathogenesis.

Here we considered development of Trim5α escape mutations (H87Q) in HIV-1 indicative of Trim5α pressure on virus replication in vivo and screened HIV-1 isolates from homosexual participants of the ACS for this mutation. We observed that Trim5α escape variants developed late in the course of infection and only in a proportion of individuals. Interestingly, individuals who developed Trim5α escape variants late in infection experienced a significantly prolonged asymptomatic phase of infection as compared to individuals who did not develop Trim5α escape variants. Our data are compatible with a model in which Trim5α mediated inhibition of viral replication contributes to control of viral load in the early phase of infection, thereby prolonging the asymptomatic phase, while at the same time selecting for the emergence of Trim5α escape variants (Fig. 3). Indeed, concomitant with Trim5α mediated control of wild-type virus replication early in infection, the viral load in individuals who developed Trim5α escape variants late in infection was significantly lower at 18 months after seroconversion as compared to individuals who did not develop Trim5α escape variants. In agreement with a relatively weak suppressive effect of human Trim5α on HIV replication, Trim5α resistant viruses developed relatively late in infection, before the onset of disease progression. One would predict that the emergence of Trim5α escape variants would precede a subsequent accelerated progression to AIDS. Lack of knowledge on the exact moment of H87Q variant development in the majority of our study population prevented us from analysing whether viral escape from Trim5α in vivo indeed results in an increase in viral RNA load and rapid disease progression (Fig. 3).

Fig. 3
Fig. 3
Image Tools

The relatively small proportion of individuals that developed Trim5α resistant viruses may suggest that Trim5α mediated inhibition is significant in only a small group of the HIV-1 infected population. Trim5α activity in this group may be enhanced by polymorphisms in the Trim5α gene [32,58–60]. The R136Q polymorphism has been associated with a slightly higher anti-HIV-1 activity of Trim5α [32]. This suggests that the 136Q variant of Trim5α might have a protective effect. Indeed, in one study it was reported that the SNP R136Q was more frequently observed in high risk seronegative as compared to HIV-1 infected individuals in African–Americans [32]. However, this could not be confirmed in other study populations [32,59]. To determine whether the development of Trim5α escape variants was due to the higher antiviral activity associated with this polymorphism, we screened our study population for the R136Q mutation. However, no association between the R136Q polymorphism and the emergence of Trim5α escape variants was observed (data not shown).

Another explanation for the relatively low prevalence of HIV-1 with Trim5α escape mutations may be a fitness cost associated with this mutation. This seems likely as in the early asymptomatic phase of infection in all HIV-1 variants from our study subjects only wild-type CyPA binding regions of capsid were observed. The H87Q mutation might result in loss of fitness, which the virus can only afford in the late phase of infection. A preliminary comparison of in vitro replication kinetics in phytohaemagglutinin stimulated PBMC of wild-type and H87Q mutant viruses did not reveal significant differences (data not shown). It remains to be elucidated whether differences in viral fitness between wild-type and H87Q mutant viruses might be more definite in direct competition assays [61].

Recently, it has been reported that mutations in the CyPA binding region were associated with CyPA independent infection in human cells [35,36,39,51]. The H87Q mutation alone or in combination with V86P, A88P, I91V and/or M96I rendered HIV-1 relatively insensitive to cyclosporine A or Debio-025 treatment, drugs that prevent the CyPA-capsid interaction. Chatterji et al. observed that substitutions at these positions were also present in naturally occurring HIV-1 variants [51]. Twenty-nine different sequences of the CyPA binding region were derived from the 24 subjects in our study that had HIV-1 variants with a mutation at position 87. A single mutation at position 87 was observed in five viruses (four H87Q; one H87P), whereas a mutation at position 87 in combination with additional mutations was observed in the other viruses (nine I91V; four I91V and M96I/L; two V86A/M; five V86A/Q/P and I91V; one V86A, I91V and M96I; two M96I; one V86M and M96I). In addition, we observed a significant association between mutations at position 86 (P = 0.000003), 91 (P = 0.0003) or 96 (P = 0.011) and the mutation at position 87 in our study population. However, no independent significant effect of these mutations on disease progression as determined by Kaplan–Meier and Cox regression analysis was observed (data not shown).

Previously the H87Q mutation was observed in HIV-1 variants isolated from HLA-B57 positive individuals. In these individuals, escape mutations in the HLA-B57 restricted cytotoxic T lymphocyte epitope TW10 were observed and it was suggested that the H87Q was a compensatory mutation to restore replicative capacity of the otherwise attenuated phenotype of the TW10 escape mutant [62]. Our study population included 12 HLA-B57 positive individuals who all had HIV-1 variants with the T242N escape mutation in the TW10 epitope. However, virus variants from only seven individuals additionally contained the H87Q mutation. Moreover, the H87Q mutation was not exclusively observed in HLA-B57 individuals, which indicates that this mutation is not specifically compensating for attenuating escape mutations in HLA-B57 restricted CTL epitopes.

In conclusion, our study is the first to provide evidence for a potential effect of Trim5α mediated inhibition of viral replication in the clinical course of HIV-1 infection. The exact magnitude of this antiviral effect and the consequences of viral escape, both for viral fitness and the clinical course of infection, remain to be elucidated before therapeutic strategies based on enhancement of Trim5α activity or Trim5α derivatives may be pursued.

Back to Top | Article Outline

Acknowledgement

This study was performed as part of the Amsterdam Cohort Studies on HIV infection and AIDS, a collaboration between the Amsterdam Health Service, the Academic Medical Centre of the University of Amsterdam, Sanquin Blood Supply Foundation and the University Medical Centre Utrecht (www.amsterdamcohortstudies.org). The ACS are part of the Netherlands HIV Monitoring Foundation and financially supported by the Netherlands National Institute for Public Health and the Environment. We are greatly indebted to all cohort participants for their continuous participation. The authors thank Brigitte Boeser-Nunnink, Floris van Alphen and Peter van Swieten for excellent technical assistance, Ronald Geskus and Maria Prins for their help with statistical analysis, and Frank Miedema and Ronald van Rij for critical reading of the manuscript.

Sponsorship: The Netherlands Organization for Scientific Research (NWO VENI grant nr 916.36.024), Dutch AIDS fund (grant 2004062) and the Landsteiner foundation for blood transfusion research (grants 0317 and 0102).

Back to Top | Article Outline

References

1. Polk BF, Fox R, Brookmeyer R, Kanchanaraksa S, Kaslow R, Visscher B, et al. Predictors of the acquired immunodeficiency syndrome developing in a cohort of seropositive homosexual men. N Engl J Med 1987; 316:61–66.

2. Lane HC, Depper JM, Greene WC, Whalen G, Waldmann TA, Fauci AS. Qualitative analysis of immune function in patients with the acquired immunodeficiency syndrome. Evidence for a selective defect in soluble antigen recognition. N Engl J Med 1985; 313:79–84.

3. Miedema F, Petit AJ, Terpstra FG, Schattenkerk JK, de Wolf F, Al BJ, et al. Immunological abnormalities in human immunodeficiency virus (HIV)-infected asymptomatic homosexual men. HIV affects the immune system before CD4+ T helper cell depletion occurs. J Clin Invest 1988; 82:1908–1914.

4. Ho DD, Neumann AU, Perelson AS, Chen W, Leonard JM, Markowitz M. Rapid turnover of plasma virions and CD4 lymphocytes in HIV-1 infection. Nature 1995; 373:123–126.

5. Wei X, Ghosh SK, Taylor ME, Johnson VA, Emini EA, Deutsch P, et al. Viral dynamics in human immunodeficiency virus type 1 infection. Nature 1995; 373:117–122.

6. Preston BD, Poiesz BJ, Loeb LA. Fidelity of HIV-1 reverse transcriptase. Science 1988; 242:1168–1171.

7. Roberts JD, Bebenek K, Kunkel TA. The accuracy of reverse transcriptase from HIV-1. Science 1988; 242:1171–1173.

8. Hofmann W, Schubert D, LaBonte J, Munson L, Gibson S, Scammell J, et al. Species-specific, postentry barriers to primate immunodeficiency virus infection. J Virol 1999; 73:10020–10028.

9. Himathongkham S, Luciw PA. Restriction of HIV-1 (subtype B) replication at the entry step in rhesus macaque cells. Virology 1996; 219:485–488.

10. Besnier C, Takeuchi Y, Towers G. Restriction of lentivirus in monkeys. Proc Natl Acad Sci USA 2002; 99:11920–11925.

11. Cowan S, Hatziioannou T, Cunningham T, Muesing MA, Gottlinger HG, Bieniasz PD. Cellular inhibitors with Fv1-like activity restrict human and simian immunodeficiency virus tropism. Proc Natl Acad Sci U S A 2002; 99:11914–11919.

12. Münk C, Brandt SM, Lucero G, Landau NR. A dominant block to HIV-1 replication at reverse transcription in simian cells. Proc Natl Acad Sci USA 2002; 99:13843–13848.

13. Hatziioannou T, Cowan S, Goff SP, Bieniasz PD, Towers GJ. Restriction of multiple divergent retroviruses by Lv1 and Ref1. Embo J 2003; 22:385–394.

14. Stremlau M, Owens CM, Perron MJ, Kiessling M, Autissier P, Sodroski J. The cytoplasmic body component TRIM5alpha restricts HIV-1 infection in Old World monkeys. Nature 2004; 427:848–853.

15. Sayah DM, Sokolskaja E, Berthoux L, Luban J. Cyclophilin A retrotransposition into TRIM5 explains owl monkey resistance to HIV-1. Nature 2004; 430:569–573.

16. Reymond A, Meroni G, Fantozzi A, Merla G, Cairo S, Luzi L, et al. The tripartite motif family identifies cell compartments. Embo J 2001; 20:2140–2151.

17. Stremlau M, Perron M, Lee M, et al. Specific recognition and accelerated uncoating of retroviral capsids by the TRIM5alpha restriction factor. Proc Natl Acad Sci USA 2006; 103:5514–5519.

18. Perron MJ, Stremlau M, Sodroski J. Two surface-exposed elements of the B30.2/SPRY domain as potency determinants of N-tropic murine leukemia virus restriction by human TRIM5alpha. J Virol 2006; 80:5631–5636.

19. Nakayama EE, Miyoshi H, Nagai Y, Shioda T. A specific region of 37 amino acid residues in the SPRY (B30.2) domain of African green monkey TRIM5alpha determines species-specific restriction of simian immunodeficiency virus SIVmac infection. J Virol 2005; 79:8870–8877.

20. Perez-Caballero D, Hatziioannou T, Yang A, Cowan S, Bieniasz PD. Human tripartite motif 5alpha domains responsible for retrovirus restriction activity and specificity. J Virol 2005; 79:8969–8978.

21. Sebastian S, Luban J. TRIM5alpha selectively binds a restriction-sensitive retroviral capsid. Retrovirology 2005; 2:40.

22. Song B, Gold B, O'Huigin C, Javanbakht H, Li X, Stremlau M, et al. The B30.2(SPRY) domain of the retroviral restriction factor TRIM5alpha exhibits lineage-specific length and sequence variation in primates. J Virol 2005; 79:6111–6121.

23. Stremlau M, Perron M, Welikala S, Sodroski J. Species-specific variation in the B30.2(SPRY) domain of TRIM5alpha determines the potency of human immunodeficiency virus restriction. J Virol 2005; 79:3139–3145.

24. Yap MW, Nisole S, Stoye JP. A single amino acid change in the SPRY domain of human Trim5alpha leads to HIV-1 restriction. Curr Biol 2005; 15:73–78.

25. Keckesova Z, Ylinen LM, Towers GJ. The human and African green monkey TRIM5alpha genes encode Ref1 and Lv1 retroviral restriction factor activities. Proc Natl Acad Sci USA 2004; 101:10780–10785.

26. Hatziioannou T, Perez-Caballero D, Yang A, Cowan S, Bieniasz PD. Retrovirus resistance factors Ref1 and Lv1 are species-specific variants of TRIM5alpha. Proc Natl Acad Sci USA 2004; 101:10774–10779.

27. Perron MJ, Stremlau M, Song B, Ulm W, Mulligan RC, Sodroski J. TRIM5alpha mediates the postentry block to N-tropic murine leukemia viruses in human cells. Proc Natl Acad Sci USA 2004; 101:11827–11832.

28. Chatterji U, Bobardt MD, Gaskill P, Sheeter D, Fox H, Gallay PA. Trim5α accelerates degradation of cytosolic capsid associated with productive HIV-1 entry. J Biol Chem 2006; 281:37025–37033.

29. Song B, Javanbakht H, Perron M, Park DH, Stremlau M, Sodroski J. Retrovirus restriction by TRIM5alpha variants from Old World and New World primates. J Virol 2005; 79:3930–3937.

30. Yap MW, Nisole S, Lynch C, Stoye JP. Trim5alpha protein restricts both HIV-1 and murine leukemia virus. Proc Natl Acad Sci USA 2004; 101:10786–10791.

31. Ylinen LM, Keckesova Z, Wilson SJ, Ranasinghe S, Towers GJ. Differential restriction of human immunodeficiency virus type 2 and simian immunodeficiency virus SIVmac by TRIM5alpha alleles. J Virol 2005; 79:11580–11587.

32. Javanbakht H, An P, Gold B, Petersen DC, O'Huigin C, Nelson GW, et al. Effects of human TRIM5alpha polymorphisms on antiretroviral function and susceptibility to human immunodeficiency virus infection. Virology 2006; 354:15–27.

33. Li Y, Li X, Stremlau M, Lee M, Sodroski J. Removal of arginine 332 allows human TRIM5alpha to bind human immunodeficiency virus capsids and to restrict infection. J Virol 2006; 80:6738–6744.

34. Sokolskaja E, Berthoux L, Luban J. Cyclophilin A and TRIM5alpha independently regulate human immunodeficiency virus type 1 infectivity in human cells. J Virol 2006; 80:2855–2862.

35. Kootstra NA, Munk C, Tonnu N, Landau NR, Verma IM. Abrogation of postentry restriction of HIV-1-based lentiviral vector transduction in simian cells. Proc Natl Acad Sci USA 2003; 100:1298–1303.

36. Ikeda Y, Ylinen LM, Kahar-Bador M, Towers GJ. Influence of gag on human immunodeficiency virus type 1 species-specific tropism. J Virol 2004; 78:11816–11822.

37. Hatziioannou T, Cowan S, Von Schwedler UK, Sundquist WI, Bieniasz PD. Species-specific tropism determinants in the human immunodeficiency virus type 1 capsid. J Virol 2004; 78:6005–6012.

38. Owens CM, Song B, Perron MJ, Yang PC, Stremlau M, Sodroski J. Binding and susceptibility to postentry restriction factors in monkey cells are specified by distinct regions of the human immunodeficiency virus type 1 capsid. J Virol 2004; 78:5423–5437.

39. Rits MAN, Van Dort KA, Münk C, Meijer AB, Kootstra NA. Efficient transduction of simian cells by HIV-1 based lentiviral vectors that contain mutations in the capsid protein. Mol Ther 2007; 15:930–937.

40. Luban J, Bossolt KL, Franke EK, Kalpana GV, Goff SP. Human immunodeficiency virus type 1 Gag protein binds to cyclophilins A and B. Cell 1993; 73:1067–1078.

41. Franke EK, Yuan HE, Luban J. Specific incorporation of cyclophilin A into HIV-1 virions. Nature 1994; 372:359–362.

42. Braaten D, Aberham C, Franke EK, Yin L, Phares W, Luban J. Cyclosporine A-resistant human immunodeficiency virus type 1 mutants demonstrate that Gag encodes the functional target of cyclophilin A. J Virol 1996; 70:5170–5176.

43. Braaten D, Franke EK, Luban J. Cyclophilin A is required for an early step in the life cycle of human immunodeficiency virus type 1 before the initiation of reverse transcription. J Virol 1996; 70:3551–3560.

44. Braaten D, Luban J. Cyclophilin A regulates HIV-1 infectivity, as demonstrated by gene targeting in human T cells. EMBO J 2001; 20:1300–1309.

45. Berthoux L, Sebastian S, Sokolskaja E, Luban J. Cyclophilin A is required for TRIM5{alpha}-mediated resistance to HIV-1 in Old World monkey cells. Proc Natl Acad Sci USA 2005; 102:14849–14853.

46. Keckesova Z, Ylinen LM, Towers GJ. Cyclophilin A renders human immunodeficiency virus type 1 sensitive to Old World monkey but not human TRIM5 alpha antiviral activity. J Virol 2006; 80:4683–4690.

47. Stremlau M, Song B, Javanbakht H, Perron M, Sodroski J. Cyclophilin A: An auxiliary but not necessary cofactor for TRIM5alpha restriction of HIV-1. Virology 2006; 351:112–120.

48. Towers GJ, Hatziioannou T, Cowan S, Goff SP, Luban J, Bieniasz PD. Cyclophilin A modulates the sensitivity of HIV-1 to host restriction factors. Nat Med 2003; 9:1138–1143.

49. Sayah DM, Luban J. Selection for loss of Ref1 activity in human cells releases human immunodeficiency virus type 1 from cyclophilin A dependence during infection. J Virol 2004; 78:12066–12070.

50. Sokolskaja E, Sayah DM, Luban J. Target cell cyclophilin A modulates human immunodeficiency virus type 1 infectivity. J Virol 2004; 78:12800–12808.

51. Chatterji U, Bobardt MD, Stanfield R, Ptak RG, Pallansch LA, Ward PA, et al. Naturally occurring capsid substitutions render HIV-1 cyclophilin A independent in human cells and TRIM-cyclophilin-resistant in Owl monkey cells. J Biol Chem 2005; 280:40293–40300.

52. de Roda Husman AM, Koot M, Cornelissen M, Keet IP, Brouwer M, Broersen SM, et al. Association between CCR5 genotype and the clinical course of HIV-1 infection. Ann Intern Med 1997; 127:882–890.

53. Geskus RB. On the inclusion of prevalent cases in HIV/AIDS natural history studies through a marker-based estimate of time since seroconversion. Stat Med 2000; 19:1753–1769.

54. Schuitemaker H, Koot M, Kootstra NA, Dercksen MW, de Goede RE, van Steenwijk RP, et al. Biological phenotype of human immunodeficiency virus type 1 clones at different stages of infection: progression of disease is associated with a shift from monocytotropic to T-cell-tropic virus population. J Virol 1992; 66:1354–1360.

55. Dull T, Zufferey R, Kelly M, Mandel RJ, Nguyen M, Trono D, et al. A third-generation lentivirus vector with a conditional packaging system. J Virol 1998; 72:8463–8471.

56. Koot M, Vos AH, Keet RP, de Goede RE, Dercksen MW, Terpstra FG, et al. HIV-1 biological phenotype in long-term infected individuals evaluated with an MT-2 cocultivation assay. Aids 1992; 6:49–54.

57. Mellors JW, Rinaldo CR Jr, Gupta P, White RM, Todd JA, Kingsley LA. Prognosis in HIV-1 infection predicted by the quantity of virus in plasma. Science 1996; 272:1167–1170.

58. Sawyer SL, Wu LI, Akey JM, Emerman M, Malik HS. High-frequency persistence of an impaired allele of the retroviral defense gene TRIM5alpha in humans. Curr Biol 2006; 16:95–100.

59. Speelmon EC, Livingston-Rosanoff D, Li SS, et al. Genetic association of the antiviral restriction factor TRIM5alpha with human immunodeficiency virus type 1 infection. J Virol 2006; 80:2463–2471.

60. Goldschmidt V, Bleiber G, May MT, Martinez R, Ortiz M, Telenti A. Role of common human TRIM5alpha variants in HIV-1 disease progression. Retrovirology 2006; 3:54.

61. Martinez-Picado J, Prado JG, Fry EE, Pfafferott K, Leslie A, Chetty S, et al. Fitness cost of escape mutations in p24 Gag in association with control of human immunodeficiency virus type 1. J Virol 2006; 80:3617–3623.

62. Leslie AJ, Pfafferott KJ, Chetty P, Draenert R, Addo MM, Feeney M, et al. HIV evolution: CTL escape mutation and reversion after transmission. Nat Med 2004; 10:282–289.

Keywords:

gag; HIV-1; pathogenesis; Trim5α; viral escape

© 2007 Lippincott Williams & Wilkins, Inc.

Login

Search for Similar Articles
You may search for similar articles that contain these same keywords or you may modify the keyword list to augment your search.