Skip Navigation LinksHome > October 1, 2007 - Volume 21 - Issue 15 > High prevalence of primary lamivudine and nelfinavir resista...
AIDS:
doi: 10.1097/QAD.0b013e3282ef3822
Research Letters

High prevalence of primary lamivudine and nelfinavir resistance in HIV-1-infected pregnant women in the United States, 1998–2004

Paredes, Rogera,b; Cheng, Irenec; Kuritzkes, Daniel Ra; Tuomala, Ruth Ed

Free Access
Article Outline
Collapse Box

Author Information

aSection of Retroviral Therapeutics, Brigham and Women's Hospital and Division of AIDS, Harvard Medical School, Boston, Massachusetts, USA

bFundacions irsi Caixa i Lluita contra la SIDA, Universitat Autònoma de Barcelona, Catalonia, Spain

cClinical Trials and Surveys Corp., Baltimore, Maryland, USA

dDivision of Maternal–Fetal Medicine, Brigham and Women's Hospital, Harvard Medical School, Boston, Massachusetts, USA.

Received 29 March, 2007

Revised 11 June, 2007

Accepted 20 June, 2007

Collapse Box

Abstract

Using a highly sensitive allele-specific polymerase chain reaction assay we detected the M184V mutation for lamivudine resistance in plasma from 9.4% of HIV-1-infected pregnant women enrolled in the Women and Infant Transmission Study between 1998 and 2004. The prevalence of nelfinavir resistance (D30N) was 6.3%. These results suggest a high prevalence of primary lamivudine and nelfinavir resistance among HIV-1-infected pregnant women in the United States, and support routine genotypic resistance testing before initiating mother-to-child-transmission prophylaxis.

Antiretroviral drug resistance can reduce the efficacy of mother-to-child transmission (MTCT) prophylaxis programmes and limit future antiretroviral treatment options for mother and child. Primary antiretroviral resistance may limit the suppression of viral replication during pregnancy-limited antiretroviral therapy (ART) [1] and facilitate further resistance evolution [2]. Resistant variants can be transmitted from mother to child, before, during, or after delivery [3].

Zidovudine, lamivudine and nelfinavir are the most frequently prescribed antiretroviral agents for MTCT prophylaxis in resource-rich settings. Phenotypic resistance to zidovudine requires the gradual accumulation of resistance mutations [4]. In contrast, single mutations in the reverse transcriptase (M184I/V) and protease (D30N) coding regions of pol, respectively, confer high-level resistance to lamivudine and nelfinavir [5,6]. Compared with routine viral population sequencing-based genotypic tests, allele-specific polymerase chain reaction (PCR) could increase the accuracy and sensitivity of primary resistance surveillance in HIV-1-infected pregnant women.

We assessed the prevalence of primary resistance to lamivudine and nelfinavir in HIV-1-infected pregnant women enrolled in the Women and Infants Transmission Study using population-based sequencing of plasma virus as well as allele-specific PCR to detect the D30N and M184V mutations. In April 2005, 1323 women who enrolled in the Women and Infants Transmission Study between 1 June 1998 and 31 December 2004 were evaluated for eligibility for this study. Study participants were HIV-1-infected pregnant women who initiated zidovudine and lamivudine therapy or zidovudine, lamivudine, and nelfinavir/nevirapine therapy during pregnancy, had never received antiretroviral therapy or had been treated for less than 15 days upon plasma specimen collection, and had a detectable HIV-RNA viral load of 500 copies/ml or greater. Of the 1323 enrolled women, 654 were ART naive before pregnancy. A total of 134 received one of the targeted regimens during pregnancy and had a study visit within 14 days of starting medications. Of these women, 94 had a viral load of 500 copies or greater at that visit and 89 had an adequate repository sample volume to participate in the study. Blinded plasma specimens were collected between June 1998 and March 2004 and were analysed in 2006 in a single laboratory.

Viral RNA was extracted from plasma (QIAamp viral RNA kit; Qiagen Inc., Valencia, California, USA), reverse-transcribed and PCR-amplified during 30 cycles (Superscript III OneStep RT/PCR; Invitrogen Corp., Carlsbad, California, USA) using primers OOPF (HXB2:2211-2232) [5′–GAAGCAGGAGCCGATAGACAAG–3′] and OOR2 (HXB2:3466-3444) [5′–TTTTCTGCCAGTTCTAGCTCTGC–3′]. The resulting PCR product was used as the starting template for a 30-cycle nested PCR amplification (High Fidelity Platinum Taq; Invitrogen Corp.) using primers OOPF2 (HXB2:2218-2241) [5′–GAGCCGATAGACAAGGAACTGTAT–3′] and OOR3 (HXB2:3457-3432) [5′–AGTTCTAGCTCTGCTTCTTCAGTTAG–3′]. The nested PCR product was purified and sequenced (3730XL DNA analyser; Applied Biosystems, Foster City, California, USA). Resistance mutations and polymorphisms were defined according to the International AIDS Society – USA Panel (Fall 2006 update) [7]. Standard phylogenetic analyses ruled out sequence contamination.

Mutations D30N and M184V were detected by allele-specific PCR using approximately 106 copies of PCR product as the starting template as reported elsewhere [8]. Results reported the mean (±SD) proportion of duplicate measurements of the rate of mutants relative to the total quasispecies. The sensitivity threshold for detecting D30N and M184V mutations was, respectively, 0.1 and 0.4%.

Eighty-nine women were included in the study (analysis I, Table 1). Resistance data were available from 64 women (72%). The D30N mutation was detected in four out of 64 specimens (6.3%) by allele-specific PCR. The proportion of D30N variants in the positive specimens was in the 0.2–31.5% range. Population-based sequencing detected the D30N mutation in two specimens (3.1%) as a mixture with the wild-type allele. By population-based sequencing, D30N was not associated with other protease inhibitor resistance mutations.

Table 1
Table 1
Image Tools

The M184V mutation was detected in six out of 64 (9.4%) specimens by allele-specific PCR. The range of proportions of M184V variants in positive specimens was 0.8–130%. Population-based sequencing confirmed the presence of the M184V mutation in four specimens (6.2% of all specimens), being found as a mixture with the wild-type allele in two of them. The M184V mutation was not associated with other reverse transcriptase mutations in any of these specimens.

The K103N mutation was detected by population-based sequencing in one subject (1.6%) one day after starting treatment with zidovudine/lamivudine. The frequency of natural polymorphisms (Table 1) was similar to that in publicly available drug resistance databases.

The overall prevalence of resistance mutations and polymorphisms did not differ when the analysis was restricted to plasma specimens obtained before any exposure to antiretroviral drugs (n = 45, analysis II, Table 1), except for the exclusion of the single specimen with the K103N mutation and one specimen with the D30N mutation.

This study suggests a high prevalence of primary lamivudine and nelfinavir resistance in HIV-1-infected pregnant women in the United States during 1998–2004. Despite the small sample size of the study, our data are consistent with earlier studies indicating an increase in the prevalence of primary nucleoside reverse transcriptase inhibitor, non-nucleoside reverse transcriptase inhibitor and protease inhibitor resistance during the same time period [9]. Our data probably reflect an increase in transmitted drug-resistant variants among the general HIV-1-infected population during the study period. The relatively short timespan between the diagnosis of HIV-1 infection and resistance testing in our study may have facilitated the detection of transmitted resistant variants. Injection drug use was infrequent in our cohort, and was not significantly associated with an increased risk of resistance (not shown). Detection of the K103N mutation in one subject one day after starting zidovudine/lamivudine therapy suggests that this mutation was present before the initiation of therapy, and that further K103N mutations could have been detected using allele-specific PCR.

Allele-specific PCR is a more sensitive method of detecting individual resistance mutations than population-based sequencing, being a useful tool for the surveillance of particularly relevant resistance mutations. The frequency of the D30N and M184V mutations increased two to threefold and 1.5-fold, respectively, when allele-specific PCR tests were utilized. Further research is warranted to establish the clinical significance of detecting very low levels of resistant variants. One retrospective study found that the presence of minor variants containing mutations K103N, Y181C and M184V in antiretroviral-naive subjects was associated with a higher likelihood of subsequent virological failure [10].

Our findings support routine genotypic resistance testing before initiating MTCT prophylaxis in the United States. They also confirm the utility of allele-specific PCR to detect single mutations conferring high-level resistance to key drug components of MTCT regimens, and support using triple-drug MTCT regimens to maximize the efficacy of this strategy and reduce the likeliness of the evolution of resistance. Further assessments of primary resistance in larger populations of HIV-1-infected pregnant women should be undertaken to confirm and extend our results. Additional analyses to assess the development of resistance in HIV-infected pregnant women during pregnancy-limited ART and virological response to subsequent antiretroviral regimens are planned.

This work was partly supported by the following US Public Health Service grants from the National Institutes of Health: R01 AI42567, K24 RR16482, a Virology Support Laboratory contract from the Adult ACTG (U01 AI-38858), and the Harvard Medical School Center for AIDS Research Virology Core (P30 AI60354). R.P. is a recipient of the ‘La Caixa’ Fellowship Grant for Post-Graduate Studies, Caixa d'Estalvis i Pensions de Barcelona, Catalonia, Spain. The Women and Infants Transmission Study principal investigators, study coordinators, programme officers and funding include: Clemente Diaz, Edna Pacheco-Acosta (University of Puerto Rico, San Juan, PR; U01 AI 034858); Ruth Tuomala, Ellen Cooper, Donna Mesthene (Boston/Worcester Site, Boston, MA; 9U01 DA 015054); Phil LaRussa, Alice Higgins (Columbia Presbyterian Hospital, New York, NY; U01 DA 015053); Sheldon Landesman, Herman Mendez, Ava Dennie (State University of New York, Brooklyn, NY; U01 HD 036117); Kenneth Rich, Delmyra Turpin (University of Illinois, Chicago, IL; U01 AI 034841); William Shearer, Norma Cooper (Baylor College of Medicine, Houston, TX; U01 HD 041983); Joana Rosario (National Institute of Allergy and Infectious Diseases, Bethesda, MD); Kevin Ryan (National Institute of Child Health and Human Development, Bethesda, MD); Vincent Smeriglio, Katherine Davenny (National Institute on Drug Abuse, Bethesda, MD); and Bruce Thompson (Clinical Trials and Surveys Corporation, Baltimore, MD; N01 AI 085339). The scientific leadership core included: Kenneth Rich (principal investigator), Delmyra Turpin (study coordinator) 1 U01 AI 050274-01. Additional support was provided by local clinical research centers as follows: Baylor College of Medicine, Houston, TX; NIH GCRC RR000188; Columbia University, New York, NY; NIH GCRC RR000645.

Back to Top | Article Outline

References

1. Shah SS, Crane M, Monaghan K, McGowan JP. Genotypic resistance testing in HIV-infected pregnant women in an urban setting. Int J STD AIDS 2004; 15:384–387.

2. Lyons FE, Coughlan S, Byrne CM, Hopkins SM, Hall WW, Mulcahy FM. Emergence of antiretroviral resistance in HIV-positive women receiving combination antiretroviral therapy in pregnancy. AIDS 2005; 19:63–67.

3. Siegrist CA, Yerly S, Kaiser L, Wyler CA, Perrin L. Mother to child transmission of zidovudine-resistant HIV-1. Lancet 1994; 344:1771–1772.

4. Boucher CA, O'Sullivan E, Mulder JW, Ramautarsing C, Kellam P, Darby G, et al. Ordered appearance of zidovudine resistance mutations during treatment of 18 human immunodeficiency virus-positive subjects. J Infect Dis 1992; 165:105–110.

5. Tisdale M, Kemp SD, Parry NR, Larder BA. Rapid in vitro selection of human immunodeficiency virus type 1 resistant to 3′-thiacytidine inhibitors due to a mutation in the YMDD region of reverse transcriptase. Proc Natl Acad Sci U S A 1993; 90:5653–5656.

6. Markowitz M, Conant M, Hurley A, Schluger R, Duran M, Peterkin J, et al. A preliminary evaluation of nelfinavir mesylate, an inhibitor of human immunodeficiency virus (HIV)-1 protease, to treat HIV infection. J Infect Dis 1998; 177:1533–1540.

7. Johnson VA, Brun-Vezinet F, Clotet B, Kuritzkes DR, Pillay D, Schapiro JM, Richman DD. Update of the drug resistance mutations in HIV-1: Fall 2006. Top HIV Med 2006; 14:125–130.

8. Paredes R, Marconi VC, Campbell TB, Kuritzkes DR. Systematic evaluation of allele-specific real time PCR for the detection of minor HIV-1 variants with pol and env resistance mutations. J Virol Meth 2007. In press.

9. Welles SL, Bauer GR, LaRussa PS, Colgrove RC, Pitt J, for the Women and Infants Transmission Study. Time trends for HIV-1 antiretroviral resistance among antiretroviral-experienced and naive pregnant women in New York city during 1991 to early 2001. J Acquir Immune Defic Syndr 2007; 44:329–335.

10. Johnson JA, Li J-F, Wei X, Craig C, Stone C, Horton JH, et al. Baseline detection of low-frequency drug resistance-associated mutations is strongly associated with virological failure in previously antiretroviral-naive HIV-1-infected persons. In: XVth International Drug Resistance Workshop, Basic Principles and Clinical Implications. Sitges, Spain. 13–17 June 2006.

© 2007 Lippincott Williams & Wilkins, Inc.

Login