Skip Navigation LinksHome > July 11, 2007 - Volume 21 - Issue 11 > Molecular mechanisms of bidirectional antagonism between K65...
AIDS:
doi: 10.1097/QAD.0b013e3281ac229b
Basic Science

Molecular mechanisms of bidirectional antagonism between K65R and thymidine analog mutations in HIV-1 reverse transcriptase

Parikh, Urvi M; Zelina, Shannon; Sluis-Cremer, Nicolas; Mellors, John W

Free Access
Article Outline
Collapse Box

Author Information

From the Division of Infectious Diseases, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania, USA.

Received 27 November, 2006

Revised 19 March, 2007

Accepted 27 March, 2007

Correspondence to John W. Mellors, Division of Infectious Diseases, University of Pittsburgh School of Medicine, S818 Scaife Hall, 3550 Terrace Street, Pittsburgh, PA 15261, USA. Tel: +1 412 624 8512; fax: +1 412 383 7982; e-mail: mellors@dom.pitt.edu

Collapse Box

Abstract

Objectives: The K65R mutation in HIV-1 reverse transcriptase (RT) decreases susceptibility to all approved nucleoside reverse transcriptase inhibitors (NRTI) except zidovudine by selectively decreasing the incorporation of the NRTI triphosphate compared with the natural deoxyribonucleotide triphosphate substrate. Thymidine analog mutations (TAMs) confer high-level resistance to zidovudine and cross-resistance to other NRTI by increasing excision of the chain-terminating NRTI monophosphate via a phosphorolytic cleavage reaction. Recent virology and genetic studies have shown bidirectional antagonism between K65R and TAMs. The aim of this study was to elucidate the biochemical and structural mechanisms responsible for this antagonism.

Methods: Steady-state and pre-steady-state kinetic analyses of NRTI triphosphate incorporation and NRTI monophosphate excision by RT containing K65R or TAMs were conducted and complemented by molecular modeling.

Results: The addition of K65R to two clinically relevant combinations of TAMs (M41L/L210W/T215Y or D67N/K70R/T215F/K219Q) significantly reduced the recombinant enzymes' ability to excise all chain-terminating NRTI monophosphate. Transient kinetic analyses showed that TAMs decreased the extent to which RT containing K65R could discriminate against D-nucleotide analogs, but not L-nucleotide analogs, by partly restoring the maximum rate of NRTI triphosphate incorporation. In addition, the TAMs combination D67N/K70R/T215F/K219Q decreased susceptibility to the L-nucleotide lamivudine by a discrimination mechanism, whereas the M41L/L210W/T215Y combination had little effect on susceptibility to lamivudine.

Conclusion: K65R antagonizes the NRTI monophosphate excision activity of RT containing TAMs. TAMs antagonize the ability of K65R RT to discriminate against the nucleotide analog. Therapies including NRTI that select for both TAMs and K65R may prolong treatment response through the mutually antagonistic interactions between these resistance mutations.

Back to Top | Article Outline

Introduction

Zidovudine, stavudine, didanosine, zalcitabine, lamivudine, emtricitabine, abacavir and tenofovir are US Food and Drug Administration-approved nucleoside analog reverse transcriptase inhibitors (NRTI) that effectively inhibit HIV-1 replication. NRTI are analogs of deoxynucleoside triphosphates (dNTP) that lack a 3′-hydroxyl group. Once incorporated into the nascent viral DNA in reactions catalysed by HIV-1 reverse transcriptase (RT), DNA synthesis cannot proceed [1,2]. Although combination therapies that contain two or more NRTI have profoundly reduced morbidity and mortality from HIV-1 infection, their long-term efficacy is limited by the selection of NRTI-resistant HIV-1.

NRTI-associated resistance mutations can be broadly categorized into two groups depending on their phenotypic mechanism of resistance [2–4]. The mutations M41L, D67N, K70R, L210W, T215F/Y and K219Q/E are typically selected by zidovudine and stavudine and are referred to as thymidine analog mutations (TAMs). TAMs increase the ability of HIV-1 RT to remove a chain-terminating NRTI monophosphate from a prematurely terminated DNA chain [5–7]. This resistance mechanism has been termed NRTI excision. By comparison, the mutations K65R, L74V, Q151M (in complex with A62V, V75I, F77L and F116Y) and M184V increase the selectivity of RT for incorporation of the natural dNTP substrate versus the NRTI triphosphate [8–12]. This resistance mechanism has been termed NRTI discrimination.

Interestingly, several mutations that confer resistance by discrimination (K65R, L74V, M184V) reverse HIV-1 resistance to zidovudine when added to a genetic background containing TAMs [13–16]. These antagonistic interactions between NRTI resistance mutations are clinically significant. For example, in patients receiving zidovudine and lamivudine dual therapy, HIV-1 rapidly develops the M184V mutation causing lamivudine resistance, but the selection of TAMs and zidovudine resistance is delayed [17]. Similarly, in patients receiving zidovudine and didanosine dual therapy, HIV-1 develops T215Y and zidovudine resistance but the selection of L74V and didanosine resistance is delayed [18]. Dual NRTI resistance can develop but generally requires the accumulation of several additional mutations [18,19]. This genetic barrier to resistance probably accounts for the clinical benefits of some dual NRTI combinations.

The K65R mutation in HIV-1 RT can be selected by tenofovir, didanosine, abacavir and stavudine and decreases susceptibility to all clinically used NRTI except zidovudine [20]. Since the introduction of tenofovir and abacavir into clinical practice, the prevalence of K65R has steadily increased in genotype databases [21,22]. Of note is the fact that several studies have shown that K65R and TAMs are bidirectionally antagonistic. In particular, we recently reported that the introduction of K65R into recombinant viruses containing different TAMs combinations reduced zidovudine resistance from over 50-fold to less than 2.5-fold [22]. In addition, TAMs were found to antagonize the phenotypic effect of K65R, decreasing resistance to tenofovir, abacavir, zalcitabine, didanosine, and stavudine, but not lamivudine [22]. Clinical studies have also suggested that TAMs decrease the likelihood of K65R selection [23–26], and that K65R and multiple TAMs are rarely found on the same viral genome even in samples in which both K65R and TAMs were detected by standard sequencing [27]. These findings highlight the in-vivo significance of the bidirectional antagonism between K65R and TAMs. The goal of the current study was to elucidate the biochemical and structural mechanisms responsible for the observed antagonism between K65R and TAMs.

Back to Top | Article Outline

Methods

Protein expression and purification

Mutant recombinant enzymes were produced by site-directed mutagenesis of wild-type HIV-1LAI RT using the QuikChange kit (Stratagene, La Jolla, California, USA). The five mutant RT studied were K65R, M41L/L210W/T215Y (TAM41), TAM41/K65R, D67N/K70R/T215F/K219Q (TAM67) and TAM67/K65R HIV-1 RT. Full-length sequencing of RT was performed to confirm the presence of the desired mutations and to exclude adventitious mutations introduced during mutagenesis. Wild-type and mutant recombinant RT were overexpressed and purified to homogeneity as described previously [28,29]. RT concentration was determined spectrophotometrically at 280 nm using an extinction co-efficient (ϵ280) of 260 450 mol−1 cm−1 and the active site concentration was calculated from pre-steady-state burst experiments [30]. All experiments described below were performed using corrected active site concentrations.

Back to Top | Article Outline
Nucleotides

Ultra-pure dNTP and dideoxynucleoside triphosphates (ddNTP) were purchased from Amersham Biosciences (Piscataway, New Jersey, USA). Zidovudine triphosphate, stavudine triphosphate and lamivudine triphosphate were purchased from Sierra Bioresearch (Tucson, Arizona, USA). Tenofovir diphosphate and carbovir triphosphate (active metabolite of abacavir) were kindly provided by Michael Miller (Gilead) and Randall Lanier (GlaxoSmithKline), respectively. Adenosine triphosphate (ATP) was purchased from Roche Diagnostics (Indianapolis, Indiana, USA).

Back to Top | Article Outline
DNA substrates

DNA oligomers were synthesized by Integrated DNA Technologies (Coralville, Iowa, USA). A 20 nucleotide DNA primer (P20; 5′–TCGGGCGCCACTGCTAGAGA–3′) and a 57 nucleotide DNA template (T57; 5′–CTCAGACCCTTTTAGTCAGAATGGAAANTCTCTAGCAGTGGCGCCCGAACAGGGACA–3′) were used to assess carbovir triphosphate, tenofovir diphosphate and lamivudine triphosphate incorporation, and carbovir monophosphate, tenofovir, lamivudine monophosphate, 2′, 5′-dideoxyadenosine (ddA) monophosphate and zalcitabine monophosphate excision. Three T57 templates were synthesized, each of which had a different nucleotide at position 30 (N). This strategy allowed us to evaluate the kinetics of single nucleotide incorporation or excision for the different NRTI using the same primer. A 19 nucleotide DNA primer (P19; 5′–GTCCCTGT TCGGGCGCCAC–3′) and a 45 nucleotide DNA template (P45; 5′–TAGTCAGAATGGAAAATC TCTAGCAGTGGCGCCCGAACAGGGACA–3′) were used to assess zidovudine triphosphate incorporation and zidovudine monophosphate and stavudine monophosphate excision. Both primers were 5′-radiolabeled with [γ-32P]-ATP (GE Healthcare, Piscataway, New Jersey, USA) and annealed to their respective templates, as described previously [31,32].

Back to Top | Article Outline
Excision assays

Excision assays provide a quantitative measurement for the ability of wild-type and mutant HIV-1 RT to carry out the phosphorolytic removal of the chain-terminating NRTI monophosphate from the 3′-end of the primer terminus. The assay used in the current study measures the rate of excision and rescue, that is, the length of time it takes to remove the chain-terminating NRTI monophosphate and add the next correct dNTP followed by ddNTP to complete the reaction. RT containing TAMs, for example, is considered to be efficient at excision, because it accomplishes this reaction in less time than wild-type RT. In this study, NRTI chain-terminated template/primer (T/P) were prepared as described previously [31,32]. The phosphorolytic removal of NRTI monophosphate was achieved by incubating 100 nmol active site RT with 20 nmol of the chain-terminated T/P complex of interest in 50 mmol Tris-hydrochloride pH 8.0, 50 mmol potassium chloride, 37°C. The reaction was initiated by the addition of 3.0 mmol ATP, 1 μmol of the next correct dNTP, 5 μmol of the appropriate ddNTP and 10 mmol magnesium chloride. Inorganic pyrophosphatase (0.01 units; Sigma, St Louis, Missouri, USA) was also included in the assay. After defined incubation periods, aliquots were removed and processed as described previously [31,32].

Back to Top | Article Outline
Single nucleotide incorporation assays

A rapid quench instrument (Kintek RQF-3 instrument; Kintek Corporation, Clarence, Pennsylvania, USA) was used for pre-steady state experiments with reaction times ranging from 5 ms to 30 min. The typical experiment was performed at 37°C in 50 mmol Tris-hydrochloride (pH 8.0) containing 50 mmol potassium chloride, 10 mmol magnesium chloride and varying concentrations of nucleotide. All concentrations reported refer to the final concentrations after mixing. An aliquot of 300 nmol active-site HIV-1 RT was pre-incubated with 50 nmol DNA substrate, before rapid mixing with nucleotide and divalent metal ions to initiate the reaction that was quenched with 0.5 mol ethylenediamine tetraacetic acid. Quenched samples were processed and quantified as described previously [31,33]. Data obtained from the single nucleotide incorporation assays were fitted by non-linear regression with Sigma Plot software (Jandel Scientific, San Raphael, California, USA) using the appropriate equations [34]. The apparent burst rate constant (kobs) for each particular concentration of dNTP was determined by fitting the time courses for the formation of product using the following equation: [product] = A[1 − exp(−kobst)], where A represents the burst amplitude. The turnover number (kpol) and apparent dissociation constant for dNTP (Kd) were then obtained by plotting the apparent catalytic rates (kobs) against dNTP concentrations and fitting the data with the following hyperbolic equation: kobs = (kpol[dNTP])/([dNTP] + Kd). The catalytic efficiency of nucleotide incorporation was calculated as the ratio of kpol/Kd, which is the ratio of the maximum rate of substrate incorporation and nucleotide binding affinity. The wild-type or mutant enzyme's selectivity for the natural dNTP versus the NRTI triphosphate analog was calculated from the ratio (kpol/Kd)dNTP/(kpol/Kd)NRTI triphosphate, which is the ratio of incorporation efficiency for each dNTP with its corresponding NRTI triphosphate [e.g. deoxycytidine triphosphate (dCTP) versus lamivudine triphosphate]. The term ‘selectivity’ is used to describe the preference (or lack of preference) for incorporation by each enzyme of the natural dNTP over the chain-terminating NRTI triphosphate. Resistance was calculated as (Selectivity)Mutant/(Selectivity)Wild-type, and enables the evaluation of the impact of resistance mutations on incorporation, taking all parameters described above into account.

Back to Top | Article Outline

Results

We recently reported that the K65R mutation reduced HIV-1 resistance to zidovudine from more than 50-fold to less than 2.5-fold in viruses with two different TAM combinations: M41L/L210W/T215Y (TAM41) and D67N/K70R/T215F/K219Q (TAM67). In addition, TAMs antagonized the phenotypic effects of K65R, decreasing resistance to abacavir (1.6-fold for TAM41/K65R; 1.8-fold for TAM67/K65R) and tenofovir (2.8-fold for TAM67/K65R). By contrast, TAMs did not decrease the effect of K65R on lamivudine resistance [22]. In the current study, we carried out in-depth biochemical analyses to address the following three questions: (i) How does K65R antagonize the NRTI monophosphate excision activity of RT containing TAM? (ii) How do TAMs antagonize the ability of RT containing K65R to discriminate between the natural dNTP substrate and NRTI triphosphate? (iii) Why is there no antagonism of lamivudine resistance in enzymes containing both TAMs and K65R?

Back to Top | Article Outline
K65R reverses thymidine analog mutation-mediated nucleoside reverse transcriptase inhibitor resistance by reducing nucleoside reverse transcriptase inhibitor monophosphate excision

The presence of three or more TAMs typically results in greater than 100-fold resistance to zidovudine and reduced susceptibility to abacavir, stavudine, didanosine, zalcitabine and tenofovir [35]. Biochemical studies have demonstrated that this reduced susceptibility is caused by the greater ability of RT containing TAMs to excise NRTI monophosphate-terminated primers in the presence of physiological concentrations of ATP or pyrophosphate [5–7]. Accordingly, we investigated the ability of RT containing TAMs or K65R to excise zidovudine monophosphate, stavudine monophosphate, tenofovir, ddA monophosphate, zalcitabine monophosphate and carbovir monophosphate (carbovir is the active metabolite of abacavir), using ATP as a pyrophosphate donor (Fig. 1). As expected, TAM41 and TAM67 RT were more efficient than wild-type RT in excising each of the NRTI monophosphates from a chain-terminated T/P (Fig. 1 and Table 1). By contrast, the rates of NRTI monophosphate excision for RT with K65R were slower than those calculated for the wild-type enzyme (Table 1). When K65R was added to either TAM41 or TAM67 RT, the NRTI monophosphate excision rates of these enzymes were decreased to wild-type levels.

Fig. 1
Fig. 1
Image Tools
Table 1
Table 1
Image Tools
Back to Top | Article Outline
Thymidine analog mutations decrease nucleoside reverse transcriptase inhibitor triphosphate discrimination conferred by K65R reverse transcriptase

The catalytic efficiency of NRTI triphosphate (and dNTP) incorporation is driven by two kinetic parameters: (i) the affinity of the nucleotide for the RT polymerase active site (Kd); and (ii) the maximum rate of nucleotide incorporation (kpol). In this regard, pre-steady-state kinetic analyses have demonstrated that K65R confers resistance to dideoxyadenosine triphosphate, lamivudine triphosphate, carbovir triphosphate and tenofovir diphosphate by selectively reducing kpol without affecting Kd [9–12]. For zalcitabine triphosphate, the resistance mechanism involves both a reduction in kpol and an increase in Kd [9]. To gain insight into the mechanism by which TAMs antagonize the phenotypic effects of K65R, pre-steady-state kinetic analyses were carried out to elucidate the interactions of the natural dNTP substrates [deoxyadenosine triphosphate (dATP), deoxyguanosine triphosphate (dGTP) and thymidine triphosphate] and nucleotide analogs (tenofovir diphosphate, carbovir triphosphate and zidovudine triphosphate) with the polymerase active sites of wild-type, K65R, TAM41, TAM67, TAM41/K65R and TAM67/K65R HIV-1 RT (Table 2). Consistent with previously published data, K65R increased the selectivity of RT for dGTP and dATP versus carbovir triphosphate and tenofovir diphosphate, respectively [11] (Table 2), and this selectivity could primarily be attributed to decreased kpol rates (Fig. 2). When K65R was added to TAMs, the selectivity of the enzymes against carbovir triphosphate was decreased 2.1-fold for TAM41/K65R and 2.8-fold for TAM67/K65R (Table 2). For tenofovir diphosphate, the selectivity was reduced 1.5-fold for TAM41/K65R and 2.4-fold for TAM67/K65R (Table 2). These decreases in selectivity were primarily caused by restoration of the maximum rate of NRTI triphosphate incorporation by TAMs (Fig. 2). Although K65R does not decrease susceptibility to zidovudine, RT containing K65R was 2.4-fold less efficient in incorporating zidovudine triphosphate compared with the wild-type RT (Table 2) [36]. The decreased catalytic efficiency of zidovudine triphosphate incorporation by RT with K65R is likely to be counteracted by decreased zidovudine monophosphate excision, resulting in no net change in zidovudine susceptibility [36].

Table 2
Table 2
Image Tools
Fig. 2
Fig. 2
Image Tools
Back to Top | Article Outline
TAM67 reverse transcriptase, but not TAM41 reverse transcriptase, discriminates between deoxycytidine triphosphate and lamivudine triphosphate

Both K65R and TAMs have been reported to decrease susceptibility to lamivudine [35]. K65R confers approximately 10–60-fold resistance to lamivudine [20,22,36], whereas TAMs confer approximately two to fivefold reduced susceptibility to lamivudine [22,35]. Our published drug susceptibility data [22] show that TAM67 confers fourfold reduced susceptibility to lamivudine, whereas TAM41 confers only a slight decrease (1.4-fold). Analysis of the ATP-mediated excision activity of wild-type RT and RT containing TAMs demonstrated that lamivudine monophosphate was inefficiently removed from a chain-terminated primer by each of the enzymes (Fig. 3), which is consistent with previously published studies [13]. Furthermore, no significant differences in the relative ability of wild-type and TAM67 RT to excise lamivudine monophosphate were noted (Fig. 3). To gain further insight into the mechanism by which TAMs confer resistance to lamivudine, pre-steady-state kinetic analyses of lamivudine triphosphate were conducted (Table 3). This analysis showed that TAM67 RT could effectively discriminate between dCTP and lamivudine triphosphate by increasing the Kd for lamivudine triphosphate without affecting dCTP binding or incorporation. By contrast, TAM41 RT incorporated lamivudine triphosphate almost as efficiently as the wild-type enzyme. These data are entirely consistent with our published results on lamivudine susceptibility of wild-type, TAM41 and TAM67 viruses [22].

Fig. 3
Fig. 3
Image Tools
Table 3
Table 3
Image Tools
Back to Top | Article Outline

Discussion

HIV-1 susceptibility studies from our laboratory have identified bidirectional, phenotypic antagonism between K65R and TAMs [22,27]. The current work provides detailed kinetic insights into the mechanisms involved in this antagonism at the enzyme level. In particular, we show that K65R antagonizes TAMs by significantly reducing the ability of RT to excise all chain-terminating NRTI monophosphate, and that TAMs antagonize K65R by diminishing the extent to which it can discriminate against D- (but not L) nucleotide analogs. Unexpectedly, we also found that TAM67 RT can confer resistance to lamivudine triphosphate by discriminating against its incorporation.

Previous studies have shown that RT containing the K65R mutation alone has a lower capacity to excise NRTI monophosphate using ATP as the excision substrate [36]. In addition, White et al. [16] recently showed that the introduction of K65R into RT containing M41L, D67N, L210W and T215Y significantly reduced the enzyme's ability to excise zidovudine monophosphate, thereby providing a mechanism by which K65R can antagonize TAMs. Our data confirm the findings of White et al. [16], and expand on them by showing that K65R inhibits the ability of RT containing TAMs to excise all of the US Food and Drug Administration-approved D-nucleoside analogs (stavudine monophosphate, tenofovir, ddA monophosphate, carbovir monophosphate, zalcitabine monophosphate). In general, this effect was caused by decreases in the rate of ATP-mediated NRTI monophosphate excision. We were, however, unable to determine the Kd for ATP for either wild-type or mutant enzymes because of experimental limitations, and thus we can not rule out the possibility that K65R might also affect ATP binding. Interestingly, the burst amplitude (the total amount of product generated in the excision assay) was significantly decreased when the ATP-mediated excision rate constant for wild-type or mutant RT was less than 0.30 min−1 (Table 1). This observed decrease in burst amplitude may result from the NRTI monophosphate excision rate approximating the rate of RT T/P dissociation, which is the overall rate-limiting step in polymerization and excision reactions [30,37].

The K70E, L74V and M184V mutations, alone or in combination with TAMs, have also been shown to impair the rescue of NRTI monophosphate chain-terminated DNA [13–15,38,39]. This supports the notion that mutations associated with the NRTI discrimination phenotype are, in general, antagonistic toward TAMs. TAMs do not, however, appear to compromise the resistance phenotypes of K70E, L74V or M184V. In the current study, we were provided with a unique opportunity to define a biochemical mechanism by which TAMs antagonize the discrimination phenotype of K65R. Consistent with previously published data [11], our results show that K65R increases the selectivity of RT for dGTP and dATP versus carbovir triphosphate and tenofovir diphosphate, respectively (Table 2), and that this selectivity could primarily be attributed to decreased kpol rates. When K65R RT is combined with TAMs, the enzyme is less able to incorporate the natural substrate selectively over the NRTI triphosphate (Table 2). Interestingly, this decrease in NRTI triphosphate selectivity is primarily caused by the TAM compensating for the decreased maximum rate of NRTI triphosphate incorporation mediated by the K65R mutation. In the crystal structures of the ternary HIV-1 RT T/P–dNTP complexes, the ϵ-amino group of K65 interacts with the γ-phosphate of the bound nucleotide substrate [40,41]. Introduction of the K65R mutation into these structures slightly alters the spatial arrangement of the nucleotide phosphate backbone [16,42] (Fig. 4a), and results in the formation of additional hydrogen bonds between R65 and the backbone N–H of D113 and W71 [16] (Fig. 4a). As described in this study and others [9–12], K65R negatively impacts kpol, a rate-constant that defines a rate-limiting conformational change that precedes phosphodiester bond formation [30]. Molecular dynamic simulation studies revealed that K65R reduces the mobility of the β3–β4 loop (as a result of the additional hydrogen bond interactions with D113 and W71) [16]. This decreased active site flexibility may be responsible for the decreased incorporation and decreased excision rates observed K65R [16]. Additional modeling analyses show that the M41L, D67N, K70R and L210W mutations do not directly alter the DNA polymerase active site structure of HIV-1 RT (data not shown). The T215F/Y mutations distort the precise positioning of residues D113 and A114 (Fig. 4b). Both of these residues display critical interactions with the phosphate backbone of the bound nucleotide substrate [40,41]. We hypothesize that these additional conformational changes induced by the T215F/Y mutations may partly compensate for the decreased active site flexibility conferred by the K65R mutation.

Fig. 4
Fig. 4
Image Tools

Interestingly, our data also demonstrate that TAM67 RT, but not TAM41 RT, confers resistance to lamivudine triphosphate via a nucleotide discrimination phenotype as opposed to an excision phenotype. These data, which are entirely consistent with the observed viral susceptibility data [22], suggest that the D67N, K70N or K219Q mutations are responsible for the lamivudine triphosphate discrimination phenotype. In addition, our data also clearly demonstrate that TAMs do not antagonize the capacity of K65R to discriminate between dCTP and lamivudine triphosphate. Therefore, the antagonism between TAMs and K65R appears to be specific towards D-nucleosides (abacavir, zidovudine, didanosine, zalcitabine, stavudine and tenofovir) and not L-nucleosides (lamivudine and emtricitabine). This specificity is probably caused by differences in the binding interactions between D- and L-NRTI triphosphate with the active site of RT.

As described previously, NRTI mutations such as L74V and M184V have also been shown to be antagonistic to TAMs [17,18]. HIV-1 isolates that exhibit dual resistance to zidovudine plus didanosine or zidovudine plus lamivudine and contain both TAMs and L74V or TAMs and M184V have been identified [18,19,43]. In these isolates, dual NRTI resistance was associated with the acquisition of either additional TAMs [18] or novel resistance mutations [19,43]. In comparison, K65R and multiple TAMs are rarely detected (< 0.1%) in the same plasma sample. If they are, DNA sequencing of single viral genomes has shown that K65R is not found on the same genome with T215F/Y and two or more TAMs except in the presence of the Q151M multi-NRTI resistance complex. The acquisition of the Q151M complex in clinical isolates containing K65R and TAMs highlights the difficulty that HIV-1 has in evolving multi-NRTI resistance with both set of mutations [27]. Taken together, these studies clearly demonstrate that there is no net advantage for HIV-1 simultaneously to evolve both the K65R and TAMs resistance pathways. Therefore, concomitant therapy with NRTI that selects for TAMs and K65R may forestall the development of NRTI resistance. Clinical trials to assess this possibility are in progress.

Sponsorship: This work was supported by a grant from the National Cancer Institute (SAIC contract 20XS190A).

Back to Top | Article Outline

References

1. Parniak MA, Sluis-Cremer N. Inhibitors of HIV-1 reverse transcriptase. Adv Pharmacol 2000; 49:67–109.

2. Sluis-Cremer N, Arion D, Parniak MA. Molecular mechanisms of HIV-1 resistance to nucleoside reverse transcriptase inhibitors (NRTIs). Cell Mol Life Sci 2000; 57:1408–1422.

3. Selmi B, Deval J, Boretto J, Canard B. Nucleotide analogue binding, catalysis and primer unblocking in the mechanisms of HIV-1 reverse transcriptase-mediated resistance to nucleoside analogues. Antivir Ther 2003; 8:143–154.

4. Deval J, Courcambeck J, Selmi B, Boretto J, Canard B. Structural determinants and molecular mechanisms for the resistance of HIV-1 RT to nucleoside analogues. Curr Drug Metab 2004; 5:305–316.

5. Arion D, Kaushik N, McCormick S, Borkow G, Parniak MA. Phenotypic mechanism of HIV-1 resistance to 3′-azido-3′-deoxythymidine (AZT): increased polymerization processivity and enhanced sensitivity to pyrophosphate of the mutant viral reverse transcriptase. Biochemistry 1998; 37:15908–15917.

6. Meyer PR, Matsuura SE, Mian AM, So AG, Scott WA. A mechanism of AZT resistance: an increase in nucleotide-dependent primer unblocking by mutant HIV-1 reverse transcriptase. Mol Cell 1999; 4:35–43.

7. Boyer PL, Sarafianos SG, Arnold E, Hughes SH. Selective excision of AZTMP by drug-resistant human immunodeficiency virus reverse transcriptase. J Virol 2001; 75:4832–4842.

8. Feng JY, Anderson KS. Mechanistic studies examining the efficiency and fidelity of DNA synthesis by the 3TC-resistant mutant (184V) of HIV-1 reverse transcriptase. Biochemistry 1999; 38:9440–9448.

9. Selmi B, Boretto J, Sarfati SR, Guerreiro C, Canard B. Mechanism-based suppression of dideoxynucleotide resistance by K65R human immunodeficiency virus reverse transcriptase using an alpha-boranophosphate nucleoside analogue. J Biol Chem 2001; 276:48466–48472.

10. Deval J, Selmi B, Boretto J, Egloff MP, Guerreiro C, Sarfati S, Canard B. The molecular mechanism of multidrug resistance by the Q151M human immunodeficiency virus type 1 reverse transcriptase and its suppression using alpha-boranophosphate nucleotide analogues. J Biol Chem 2002; 277:42097–42104.

11. Deval J, White KL, Miller MD, Parkin NT, Courcambeck J, Halfon P, et al. Mechanistic basis for reduced viral and enzymatic fitness of HIV-1 reverse transcriptase containing both K65R and M184V mutations. J Biol Chem 2004; 279:509–516.

12. Deval J, Navarro JM, Selmi B, Courcambeck J, Boretto J, Halfon P, et al. A loss of viral replicative capacity correlates with altered DNA polymerization kinetics by the human immunodeficiency virus reverse transcriptase bearing the K65R and L74V dideoxynucleoside resistance substitutions. J Biol Chem 2004; 279:25489–25496.

13. Naeger LK, Margot NA, Miller MD. Increased drug susceptibility of HIV-1 reverse transcriptase mutants containing M184V and zidovudine-associated mutations: analysis of enzyme processivity, chain-terminator removal and viral replication. Antivir Ther 2001; 6:115–126.

14. Boyer PL, Sarafianos SG, Arnold E, Hughes SH. The M184V mutation reduces the selective excision of zidovudine 5′-monophosphate (AZTMP) by the reverse transcriptase of human immunodeficiency virus type 1. J Virol 2002; 76:3248–3256.

15. Miranda LR, Gotte M, Liang F, Kuritzkes DR. The L74V mutation in human immunodeficiency virus type 1 reverse transcriptase counteracts enhanced excision of zidovudine monophosphate associated with thymidine analog resistance mutations. Antimicrob Agents Chemother 2005; 49:2648–2656.

16. White KL, Chen JM, Feng JY, Margot NA, Ly JK, Ray AS, et al. The K65R reverse transcriptase mutation in HIV-1 reverses the excision phenotype of zidovudine resistance mutations. Antivir Ther 2006; 11:155–163.

17. Larder BA, Kemp SD, Harrigan PR. Potential mechanism for sustained antiretroviral efficacy of AZT–3TC combination therapy. Science 1995; 269:696–699.

18. Shafer RW, Kozal MJ, Winters MA, Iversen AK, Katzenstein DA, Ragni MV, et al. Combination therapy with zidovudine and didanosine selects for drug-resistant human immunodeficiency virus type 1 strains with unique patterns of pol gene mutations. J Infect Dis 1994; 169:722–729.

19. Stoeckli TC, MaWhinney S, Uy J, Duan C, Lu J, Shugarts D, Kuritzkes DR. Phenotypic and genotypic analysis of biologically cloned human immunodeficiency virus type 1 isolates from patients treated with zidovudine and lamivudine. Antimicrob Agents Chemother 2002; 46:4000–4003.

20. Parikh UM, Koontz DL, Chu CK, Schinazi RF, Mellors JW. In vitro activity of structurally diverse nucleoside analogs against human immunodeficiency virus type 1 with the K65R mutation in reverse transcriptase. Antimicrob Agents Chemother 2005; 49:1139–1144.

21. Winston A, Mandalia S, Pillay D, Gazzard B, Pozniak A. The prevalence and determinants of the K65R mutation in HIV-1 reverse transcriptase in tenofovir-naive patients. AIDS 2002; 16:2087–2089.

22. Parikh UM, Bacheler L, Koontz D, Mellors JW. The K65R mutation in human immunodeficiency virus type 1 reverse transcriptase exhibits bidirectional phenotypic antagonism with thymidine analog mutations. J Virol 2006; 80:4971–4977.

23. Miller MD. K65R, TAMs and tenofovir. AIDS Rev 2004; 6:22–33.

24. Valer L, Martin-Carbonero L, de Mendoza C, Corral A, Soriano V. Predictors of selection of K65R: tenofovir use and lack of thymidine analogue mutations. AIDS 2004; 18:2094–2096.

25. Segondy M, Montes B. Prevalence and conditions of selection of the K65R mutation in the reverse transcriptase gene of HIV-1. J Acquir Immune Defic Syndr 2005; 38:110–111.

26. Wirden M, Marcelin AG, Simon A, Kirstetter M, Tubiana R, Valantin MA, et al. Resistance mutations before and after tenofovir regimen failure in HIV-1 infected patients. J Med Virol 2005; 76:297–301.

27. Parikh UM, Barnas DC, Faruki H, Mellors JW. Antagonism between the HIV-1 reverse-transcriptase mutation K65R and thymidine-analogue mutations at the genomic level. J Infect Dis 2006; 194:651–660.

28. Le Grice SF, Gruninger-Leitch F. Rapid purification of homodimer and heterodimer HIV-1 reverse transcriptase by metal chelate affinity chromatography. Eur J Biochem 1990; 187:307–314.

29. Le Grice SF, Cameron CE, Benkovic SJ. Purification and characterization of human immunodeficiency virus type 1 reverse transcriptase. Methods Enzymol 1995; 262:130–144.

30. Kati WM, Johnson KA, Jerva LF, Anderson KS. Mechanism and fidelity of HIV reverse transcriptase. J Biol Chem 1992; 267:25988–25997.

31. Sluis-Cremer N, Arion D, Parikh U, Koontz D, Schinazi RF, Mellors JW, Parniak MA. The 3′-azido group is not the primary determinant of 3′-azido-3′-deoxythymidine (AZT) responsible for the excision phenotype of AZT-resistant HIV-1. J Biol Chem 2005; 280:29047–29052.

32. Arion D, Sluis-Cremer N, Parniak MA. Mechanism by which phosphonoformic acid resistance mutations restore 3′-azido-3′-deoxythymidine (AZT) sensitivity to AZT-resistant HIV-1 reverse transcriptase. J Biol Chem 2000; 275:9251–9255.

33. Radzio J, Sluis-Cremer N. Stereo-selectivity of HIV-1 reverse transcriptase toward isomers of thymidine-5(-O-1-thiotriphosphate. Protein Sci 2005; 14:1929–1933. E-pub 3 June 2005.

34. Johnson KA. Rapid quench kinetic analysis of polymerases, adenosinetriphosphatases, and enzyme intermediates. Methods Enzymol 1995; 249:38–61.

35. Whitcomb JM, Parkin NT, Chappey C, Hellmann NS, Petropoulos CJ. Broad nucleoside reverse-transcriptase inhibitor cross-resistance in human immunodeficiency virus type 1 clinical isolates. J Infect Dis 2003; 188:992–1000.

36. White KL, Margot NA, Ly JK, Chen JM, Ray AS, Pavelko M, et al. A combination of decreased NRTI incorporation and decreased excision determines the resistance profile of HIV-1 K65R RT. AIDS 2005; 19:1751–1760.

37. Ray AS, Murakami E, Basavapathruni A, Vaccaro JA, Ulrich D, Chu CK, et al. Probing the molecular mechanisms of AZT drug resistance mediated by HIV-1 reverse transcriptase using a transient kinetic analysis. Biochemistry 2003; 42:8831–8841.

38. Gotte M, Arion D, Parniak MA, Wainberg MA. The M184V mutation in the reverse transcriptase of human immunodeficiency virus type 1 impairs rescue of chain-terminated DNA synthesis. J Virol 2000; 74:3579–3585.

39. Frankel FA, Marchand B, Turner D, Gotte M, Wainberg MA. Impaired rescue of chain-terminated DNA synthesis associated with the L74V mutation in human immunodeficiency virus type 1 reverse transcriptase. Antimicrob Agents Chemother 2005; 49:2657–2664.

40. Tuske S, Sarafianos SG, Clark AD Jr, Ding J, Naeger LK, White KL, et al. Structures of HIV-1 RT-DNA complexes before and after incorporation of the anti-AIDS drug tenofovir. Nat Struct Mol Biol 2004; 11:469–474.

41. Huang H, Chopra R, Verdine GL, Harrison SC. Structure of a covalently trapped catalytic complex of HIV-1 reverse transcriptase: implications for drug resistance. Science 1998; 282:1669–1675.

42. Sluis-Cremer N, Arion D, Kaushik N, Lim H, Parniak MA. Mutational analysis of Lys65 of HIV-1 reverse transcriptase. Biochem J 2000; 348:77–82.

43. Kemp SD, Shi C, Bloor S, Harrigan PR, Mellors JW, Larder BA. A novel polymorphism at codon 333 of human immunodeficiency virus type 1 reverse transcriptase can facilitate dual resistance to zidovudine and L-2′,3′-dideoxy-3′-thiacytidine. J Virol 1998; 72:5093–5098.

Keywords:

Antiretroviral therapy; antiviral drug resistance; HIV-1; K65R; nucleoside reverse transcriptase inhibitors; reverse transcriptase; thymidine analog mutations

© 2007 Lippincott Williams & Wilkins, Inc.

Login

Search for Similar Articles
You may search for similar articles that contain these same keywords or you may modify the keyword list to augment your search.