Skip Navigation LinksHome > May 31, 2007 - Volume 21 - Issue 9 > Polymorphisms in IRF-1 associated with resistance to HIV-1 i...
AIDS:
doi: 10.1097/QAD.0b013e3280ef6ae1
Basic Science

Polymorphisms in IRF-1 associated with resistance to HIV-1 infection in highly exposed uninfected Kenyan sex workers

Ball, Terry Blakea; Ji, Hezhaoa; Kimani, Joshuab; McLaren, Paula; Marlin, Crystala; Hill, Adrian VSc; Plummer, Francis Allana,d

Free Access
Article Outline
Collapse Box

Author Information

From the aDepartment of Medical Microbiology and Infectious Diseases, University of Manitoba, Winnipeg, Manitoba, Canada

bDepartment of Microbiology, University of Nairobi, Nairobi, Kenya

cThe Wellcome Trust Centre for Human Genetics, Department of Clinical Medicine, University of Oxford, Oxford, UK

dNational Microbiology Laboratory, Canadian Science Center for Human and Animal Health, Winnipeg, Manitoba, Canada.

Received 13 September, 2006

Revised 30 December, 2006

Accepted 19 January, 2007

Correspondence to Terry Blake Ball, Department of Medical Microbiology and Infectious Diseases, University of Manitoba, Room 507, Basic Medical Science Building, 730 William Avenue, Winnipeg, Manitoba, Canada R3E0W3. Tel: +1 204 789 3202; e-mail: tball@cc.umanitoba.ca

Collapse Box

Abstract

Objective: To determine the correlation between polymorphisms in the IL-4 gene cluster and resistance to HIV-1 infection.

Design: A cross-sectional genetic analysis of polymorphisms within the IL-4 gene cluster was conducted in a well-described female sex worker cohort from Nairobi, Kenya, known to exhibit differential susceptibility to HIV-1 infection.

Methods: Microsatellite genotyping was used to screen six microsatellite markers in the IL-4 gene cluster for associations with HIV-1 resistance. Further analysis of the interferon regulatory factor 1 (IRF-1) gene was conducted by genomic sequencing. Associations between IRF-1 gene polymorphisms and the HIV-1 resistance phenotype were determined using the chi-square test and Kaplan–Meier survival analysis. The functional consequence of IRF-1 polymorphism was conducted by quantitative Western blot.

Results: Three polymorphisms in IRF-1, located at 619, the microsatellite region and 6516 of the gene, showed associations with resistance to HIV-1 infection. The 619A, 179 at IRF-1 microsatellite and 6516G alleles were associated with the HIV-1-resistant phenotype and a reduced likelihood of seroconversion. Peripheral blood mononuclear cells from patients with protective IRF-1 genotypes exhibited significantly lower basal IRF-1 expression and reduced responsiveness to exogenous IFN-γ stimulation.

Conclusion: Polymorphisms in the IRF-1 gene are associated with resistance to infection by HIV-1 and a lowered level of IRF-1 protein expression. This study adds IRF-1, a transcriptional immunoregulatory gene, to the list of genetic correlates of altered susceptibility to HIV-1. This is the first report suggesting that a viral transcriptional regulator might contribute to resistance to HIV-1. Further functional analysis on the role of IRF-1 polymorphisms and HIV-1 resistance is underway.

Back to Top | Article Outline

Introduction

Altered susceptibility to HIV-1 infection has been observed in multiple cohort studies especially in highly exposed sex workers [1–5]. Understanding the mechanisms behind this will contribute to the development of preventive and therapeutic strategies against HIV/AIDS. One of the best characterized HIV-1-exposed, uninfected group is a commercial sex worker cohort from Nairobi, Kenya, where some individuals can be epidemiologically defined as resistant to infection by HIV-1 [1,6]. Resistance is not related to differences in sexual behavior, condom use, sexually transmitted infections, or differing HIV-1 exposure. Immunologically, resistance correlates with systemic HIV-1-specific T-helper responses, systemic and mucosal cytotoxic T-lymphocyte responses, HIV-1-specific mucosal IgA levels [6–9], and a global IL-4 hyporesponsiveness to HIV-1 and other antigens [10]. Those findings suggest that HIV-1-resistant individuals exhibit a biased cellular or T helper type 1 (Th1) immune responses to HIV-1. Genetic studies suggest that specific human leukocyte antigen (HLA) genotypes, but not polymorphisms in HIV-1 co-receptor molecules or their natural ligands, correlate with HIV-1-resistance [11–14]. We hypothesize that other genetic mechanisms account for the development of resistance to HIV-1 mediated by these putatively protective immune responses.

The human IL-4 gene cluster located on chromosome 5 is homologous to the mouse T helper type 2 (Th2) gene cluster and harbours several immunoregulatory genes such as IL-3, IL-4, IL-5, IL-13 and interferon regulatory factor 1 (IRF-1), all critical in the differentiation of cellular (Th1) and humoral (Th2) immune responses. Polymorphisms in this region have been linked to altered susceptibility to numerous infections and immunopathologies including schistosomiasis and allergy/atopy [15–17], in which pathogenesis depends on the regulation of cellular and humoral immune responses. To test the hypothesis that genetic variation(s) in this region are associated with resistance to infection by HIV-1, we determined whether polymorphisms in the IL-4 gene cluster are associated with the resistance phenotype in our Kenyan sex-worker cohort.

Back to Top | Article Outline

Materials and methods

Subjects

In total, 687 subjects from a well-described Kenyan female sex worker cohort were included in this study [1]. Enrollees were questioned on factors such as condom use, sex partners per day, and as previously described demonstrated equal risk-taking behaviours [1]. Subjects were asked to describe their ethnicity and tribal origin, which was equally distributed between study groups. All subjects were classified into two epidemiologically defined groups: HIV-1 resistant if subjects met our previously established definition of HIV-1 resistance [seronegative on enrollment, HIV-1 negative by serology and polymerase chain reaction (PCR) for over 3 years of follow-up]; subjects HIV-1 positive at enrollment or seroconverting during follow-up were classified as HIV-1 susceptible [1,6]. Subjects gave informed consent and the study was approved by the University of Manitoba and University of Nairobi institutional review boards.

Back to Top | Article Outline
DNA isolation

Peripheral blood samples were obtained and DNA was extracted from peripheral blood mononuclear cells (PBMC) isolated by Ficoll–Hypaque centrifugation, or from whole blood using the Qiagen DNA extraction kit (Qiagen, Inc., Mississauga, Canada) or the Puregene DNA extraction kit (Gentra Systems, Minneapolis, USA).

Back to Top | Article Outline
Microsatellite typing

Six microsatellite markers spanning the IL-4 gene cluster were screened. Primers (5′–3′, annealing temperatures in parenthesis) specific for individual microsatellite markers: D5S666 forward (f) AGCTGCATTCTCATGGTTTATCTTG, and reverse (r) GTGCCTGGCTTATTTCAC TTAACA (55°C); D5S1984 (f) CCAGCCCGCTTAGTGT and (r) TAGGAGGCTTCCCACATCT (58°); IL-4 microsatellite (f) TGCACCTGGGCAACAGTTTA and (r) GTTGGATGGACTTGGAGATT (58°C); IRF-1 microsatellite (f) ATGGCAGATAGGTCCACCGG and (r) TCATCCTCATCTG TTGTAGC (55°C); D5S2115 (f) GGCACTCATGCTGCACT and (r) GTAAGC CCCTGGCTCCT (55°C); D5S399 (f) GAGTGTATCAGTCAGGGTGC and (r) GGCCTCAACTTCATAATCAA (58°C). All primers were obtained from PE-Applied Biosystems (Cheshire, UK) with one segment of each pair end-labelled with FAM, TET or HEX fluorescent markers. Microsatellite typing assays were performed with the operator blinded to the subject's HIV phenotype [18]. PCR amplification was conducted with the 15 μl reaction mixture containing 10 mmol Tris hydrochloride (pH 8.3), 25 mmol potassium chloride, 1 mmol magnesium chloride, 15 mmol ammonium sulphate, 200 μmol deoxyribonucleotide triphosphate mixture, 1.5 pmol of each primer, 0.4 U of Amplitaq Gold Polymerase (Perkin Elmer, Norwalk, Connecticut, USA) and 50 ng of DNA template. PCR was performed on a thermocycler as follows: an initial denaturation step of 14 min at 94°C; 35 cycles of 15 s at 94°C; 30 s at the specified annealing temperatures, and 30 s elongation at 72°C. The samples were resolved on an ABI Prism 373 DNA sequencer (PE-Applied Biosystems, Norwalk, Connecticut, USA) and genotypes were determined using GeneScan software.

Back to Top | Article Outline
Western blot analysis

PBMC from HIV-1-negative subjects with different IRF-1 genotypes at the 619, 6516 and microsatellite region were isolated by Ficoll–Hypaque centrifugation. For basal IRF-1 expression measurement, 2.5 × 105 cells were lysed with 1 × sample buffer and separated by 10% sodium dodecylsulphate polyacrylamide gel electrophoresis before transfer to a nitrocellulose membrane. The membrane was probed with an anti-human IRF-1 polyclonal antibody (sc-497; Santa Cruz Biotechnology, Santa Cruz, California, USA). Actin, a housekeeping protein was probed in parallel with an anti-actin polyclonal antibody (sc-1616; Santa Cruz Biotechnology) as an internal control. Quantitative analysis was conducted via spot densometry using the Fluorchem 8800 imaging system (Alpha Innotech Corporation, San Leandro, California, USA). The IRF-1: actin ratio was used as an index for intragroup comparisons. For IFN-γ stimulation experiments, PBMC were cultured with or without 1 ng/ml IFN-γ for 18 h. The cells were harvested in phosphate-buffered saline and Western blot analysis for IRF-1 protein was performed as described. The fold increase of IRF-1 expression compared with basal expression after IFN-γ stimulation was calculated and compared between genotypic subgroups.

Back to Top | Article Outline
Statistical analysis

Differences in microsatellite allele distributions, IRF-1 allele, genotype or haplotype distributions between HIV-1-resistant and susceptible groups were analysed by chi-square analysis. In cases in which contingency tables had less than five expected events per cell, less frequent alleles were collapsed into their own group and the table was reconstructed. These results were confirmed by Monte Carlo simulations. Kaplan–Meier and Cox regression survival analysis was used to compare HIV-1-free time in subjects who were enrolled into the cohort as HIV-1 negative, some of whom subsequently seroconverted during follow-up with different IRF-1 genotypes and haplotypes. Kaplan–Meier survival analysis was also conducted to evaluate the effects of IRF-1 genotypes on the time to clinically defined AIDS (CD4 cell counts < 200 cells/μl) in infected, antiretroviral-naive patients. Log linear modelling and logistic regression was utilized to assess the independence of associations of IRF-1 polymorphisms and HIV-1 resistance. The non-parametric Mann–Whitney test (two tailed) was utilized for the analysis of Western blot results.

Back to Top | Article Outline

Results

Two microsatellite markers in IL-4 gene cluster associated with resistance to HIV-1 infection

Six microsatellite markers spanning the IL-4 gene cluster (D5S666, D5S1984, IL-4 microsatellite, IRF-1 microsatellite, D5S2115 and D5S399) were tested in 402–595 HIV-1-infected susceptible women and 65–92 HIV-1-resistant women. The number of subjects varied because of a lack of biological material to type all markers. Microsatellite genotype frequencies were compiled to determine the allele distribution in both groups. Analyses indicated differences in allele distributions for D5S1984 and IRF-1 microsatellite markers between HIV-1-resistant and susceptible groups (P = 0.02 and 0.0035 for D5S1984 and P = 0.015 and 0.037 for IRF-1 microsatellite in ungrouped and grouped analysis, respectively; Table 1). No significant difference was observed for any other markers.

Table 1
Table 1
Image Tools
Back to Top | Article Outline
IRF-1 179 allele associated with HIV-1 resistance and decreased likelihood of seroconversion

Although the allele distributions in the D5S1984 marker differed significantly between the two groups, no specific allele was associated with the resistance phenotype. The 219 and 227 allele frequencies were higher, whereas the 215 and 225 allele frequencies were lower in the HIV-1-resistant women. In contrast, the 179 allele at IRF-1 microsatellite (12 ‘GT’ dinucleotide repeats in intron 7) was clearly overrepresented in HIV-1-resistant subjects. We further examined the genotypic and allelic frequencies of specific IRF-1 microsatellite alleles in all available subjects (86 HIV-1-resistant and 595 HIV-1-susceptible subjects). The IRF-1 179 allele was strongly associated with the resistance phenotype although exerting a weak protective effect [P = 0.0054, odds ratio (OR) 1.60, 95% confidence interval (CI) 1.14–2.23; Table 2]. In addition, Kaplan–Meier survival and Cox regression analysis demonstrated that initially HIV-1-uninfected subjects with at least one copy of the 179 allele showed significantly longer HIV-1-free survival, and therefore decreased seroconversion compared with those lacking this allele [P = 0.039, hazard ratio (HR) 0.708, 95% CI 0.509∼0.985, log rank 4.24; Fig. 1a].

Table 2
Table 2
Image Tools
Fig. 1
Fig. 1
Image Tools
Back to Top | Article Outline
Two single nucleotide polymorphisms in IRF-1 associated with resistance to HIV-1 infection

The identification of IRF-1 as a candidate gene to explain, at least partly, natural resistance to infection by HIV-1 is supported by considerable data demonstrating that IRF-1 plays a key role in host immunity [19,20], as well as mediating HIV-1 early transcription and replication [21,22]. A previous comparative sequence analysis of the IRF-1 gene and its promoter region demonstrated that IRF-1 is highly polymorphic containing at least 53 individual single nucleotide polymorphisms (SNP) [23]. Association analysis of all polymorphisms revealed that two SNP at position 619 (A > C; rs17848395) and 6516 (G > T; rs17848424) were differentially represented in HIV-1-resistant women compared with HIV-1-susceptible subjects (Table 2). The other polymorphisms showed no association with the HIV resistance phenotype. The 619A and 6516G alleles were significantly associated with HIV-1 resistance, whereas the alternative alleles (619C and 6516T) were associated with the HIV-1-susceptible phenotype (P = 0.00068 and 0.030, respectively). Genotype analysis confirmed this, demonstrating that genotypes containing 619A, 179 at IRF-1 microsatellite and 6516G were all significantly overrepresented in HIV-1-resistant subjects (Table 2). After correcting for multiple comparisons only the 619 SNP remained significant (data not shown). Kaplan–Meier and Cox regression survival analysis demonstrated that initially HIV-1-uninfected subjects with at least one copy of the 619 allele showed significantly longer HIV-1-free survival and decreased seroconversion compared with those lacking this allele (P = 0.002, HR 0.528, 95% CI 0.353∼0.790, log rank 10.00; Fig. 1b). Although not significant, a trend was observed for the 6516G allele (Fig. 1c).

Back to Top | Article Outline
Polymorphisms associated with resistance to HIV infection co-segregate, revealing the 619 single nucleotide polymorphism as the strongest independent determinant

Linkage disequilibrium (LD) is common in IRF-1 [23] and among the three polymorphisms associated with resistance to HIV-1 infection. The three protective IRF-1 alleles (619A, 179 and 6516G) tend to co-segregate. Pairwise LD analysis of 619A: 179 microsatellite; 179 microsatellite: 6516G; or 619A: 6516G showed that these three polymorphisms were in significant LD (for all P < 0.0001). Log linear multivariate modelling and logistic regression analysis identified the 619A allele as the primary independent association with HIV-1 resistance (P = 0.0022), whereas the other polymorphisms were associated with the resistance phenotype probably as a result of LD with 619A (P = NS for both excluding LD effects). Furthermore, multivariate regression analysis determined that this effect was independent of the previously reported association with the HLA A2/6802 supertype (data not shown) [13,14].

Back to Top | Article Outline
Haplotypes containing more than one protective allele associated with resistance to HIV-1 infection

Although 619A was the primary allele associated with HIV-1 resistance, it is possible that combinations of protective alleles provide a stronger association with HIV-1 resistance and reduced seroconversion as suggested in Table 2 and Figure 1, respectively. We conducted haplotype analysis, where possible, in individuals homozygous for two or more of these alleles. We found that all combinations of protective alleles (619A + 179, 179 + 6516G, 619A + 6516G and 619A + 179 + 6516G) showed an even more significant association with protection from HIV-1 infection (OR 1.8–2.71 and P = 0.0114, 0.005, 0.0006, and 0.008, respectively; Table 2). Therefore, compared with individual alleles, additional alleles provide additive protection against HIV-1 infection. The numbers of subjects with discrete haplotypes were insufficient to conduct survival analysis.

When we assessed the combinatorial effects of having at least one copy of either the 619A, 179 or the 6516G allele, we found that 79.3% of HIV-1-resistant women carried at least one of these alleles compared with 55.6% of susceptible women (P = 0.0003, OR 2.97, 95% CI 1.61∼5.53). In survival analysis, we found that initially uninfected subjects having any one of these protective alleles had significantly longer HIV-1-free survival and reduced likelihood of seroconversion compared with individuals lacking these alleles (P = 0.0001, HR 0.458, 95% CI 0.305∼0.689, log rank 14.81; Fig. 1d). Interestingly, the strength of these associations as determined by hazard ratios suggested that the protective effect may be similar to individual alleles. Efforts to determine the combinatorial protective effects of one, two or all three of the protective alleles were unfeasible as a result of small sample sizes.

Back to Top | Article Outline
IRF-1 polymorphisms not associated with varied HIV-1 disease progression

To determine whether polymorphisms in IRF-1 play any role in HIV disease progression, we conducted Kaplan–Meier survival analysis to compare the duration between the first positive day in the cohort and time to CD4 cell decline to less than 200 cells/μl, clinically defined as progression to AIDS. The results are depicted in Figure 2. No significant differences were observed between subjects with or without the 619A or 6516G alleles (P = 0.8572 and 0.2405). A marginally significant difference was observed for the 179 microsatellite, with heterozygous subjects appearing to show faster progression (P = 0.0426). These data suggest that the protection offered by specific IRF-1 genotypes may only be active during the initiation of HIV-1 infection but not after infection is fully established.

Fig. 2
Fig. 2
Image Tools
Back to Top | Article Outline
IRF-1 genotypes that associate with resistance to HIV-1 correlate with reduced basal IRF-1 expression

With the exception of early embryonic cells, IRF-1 is expressed at low basal levels in all cell types [19]. Western blot analysis showed no electrophoretic pattern difference between PBMC from subjects with different IRF-1 genotypes. Quantitative analysis indicated that PBMC from subjects homozygous for the 619A allele (619AA) had significantly less IRF-1 protein levels compared with those from 619A/C heterozygotes or 619CC homozygotes (P = 0.0011 and 0.0010, respectively, Fig. 3a). Similarly, 6516G homozygotes showed reduced basal IRF-1 protein compared with heterozygous (6516GT) or 6516TT homozygotes (P = 0.0028 and 0.0015, respectively, Fig. 3b). A similar trend was observed comparing subjects with different IRF-1 microsatellite genotypes, although a significant difference was observed only between individuals homozygous for the 179 allele and individuals lacking the 179 allele entirely (P = 0.009; Fig. 3c).

Fig. 3
Fig. 3
Image Tools
Back to Top | Article Outline
IRF-1 genotypes that associate with resistance to HIV-1 also correlate with reduced responsiveness to exogenous IFN-γ stimulation

Using IFN-γ, a potent and commonly used IRF-1 stimulus, we determined whether polymorphisms in IRF-1 associated with altered IRF-1 responsiveness to exogenous stimulation. PBMC from individuals homozygous for alleles associated with HIV-1 resistance at 619 and 6516 (619A and 6516G) showed a significantly lower fold increase in IRF-1 expression compared with individuals heterozygous or homozygous for the alternative alleles (P = 0.0017 and 0.0019 for 619AA versus 619AC or 619CC, respectively; P = 0.0019 and 0.0008 for 6516GG versus 6516GT or 6516TT, respectively). No differences were observed between individuals heterozygous and homozygous for the non-associated alleles (Fig. 3d and e), nor among the different IRF-1 microsatellite markers (Fig. 3f).

Back to Top | Article Outline

Discussion

In the present study, we identified a single microsatellite allele (IRF-1 179) within the IL-4 gene cluster associating with the HIV-1 resistance phenotype and protecting against seroconversion in prospective survival analysis. Comparative sequencing of the IRF-1 gene in this population revealed two additional SNP (619A > C and 6516G > T) that correlated with the HIV-1-resistant phenotype and a reduced likelihood of seroconversion. Logistic regression suggested that 619A was the primary association with HIV-1 resistance. Haplotype analysis suggested, however, that the protective effect of these alleles was additive. Regardless of the dominance of one particular allele it is clear that one or more of these polymorphisms is associating strongly with resistance to infection by HIV-1. Further analysis is underway to try to understand the addition, or independence of these observations, including efforts to assign IRF-1 haplotypes better. Perhaps most interestingly, however, these polymorphisms did not associate with altered disease progression, suggesting that protection may be limited to the initial stages of HIV-1 infection but not after infection has been established.

These polymorphisms are all located within introns in the IRF-1 gene, and how these non-coding changes affected IRF-1 expression was not clear. Measuring IRF-1 protein levels directly, we demonstrated PBMC from subjects with protective IRF-1 genotypes had lower IRF-1 protein levels both at baseline and in response to exogenous IFN-γ stimulation. We note that differences in protein expression were most significant only between the extreme genotypes for all three polymorphisms (619AA versus 619CC, 6516GG versus 6516TT, two ‘179’ versus no ‘179’), whereas the genetic data suggest a dominant genetic effect. We believe that as IRF-1 regulation is extremely complex, we may only be capable of observing the biological effects between the most extreme genotypes. The mechanism of how these intronic polymorphisms alter IRF-1 expression is unknown. Polymorphism in introns can affect gene expression by influencing transcription, messenger RNA splicing, translation, mRNA stability, or promoter activity [24–30]. Functional mechanistic studies are underway to establish how these polymorphisms affect IRF-1 protein levels.

Why does reduced IRF-1 associate with resistance to infection by HIV-1? IRF-1 is a transcriptional activator of interferon-inducible genes via binding to interferon-stimulated response elements in their promoter regions [19]. IRF-1 plays a critical role in the regulation of host cellular immune responses, and it has been well demonstrated in IRF-1 knockout mice that these mice demonstrate defects in CD8 T-cell development, a CD4 T-cell shift from Th1 to Th2 cytokine expression, decreases in the numbers and function of natural killer cells, and decreased MHC and polymeric immunoglobulin receptor expression [19,20]. Studies on HIV-1-resistant women from this cohort have demonstrated that these women exhibit a Th1-biased response with HIV-1-specific cellular, but not humoral, responses, as well as a compartmentalized mucosal antibody response [6,8,9]. IRF-1 probably plays a critical role in the generation of these immune responses. That the protective IRF-1 genotypes associate with lower, but not higher IRF-1 protein expression is somewhat counterintuitive, as one would assume that this would result in lower interferon responses and perhaps a blunted cellular response. This does not occur, however, as HIV-1-resistant women have cell-mediated immune responses to HIV-1. This suggests that the generation of presumably protective immune responses against HIV-1 is not solely dependent on IRF-1 levels or that only a low threshold level of IRF-1 is required to maintain its normal physiological functions.

How then, may lowered IRF-1 expression result in resistance to infection by HIV-1? Reconciliation may lie with the potential role of IRF-1 in modulating HIV-1 replication. IRF-1 binds to an interferon-stimulated response element-like sequence in the HIV-1 5′–long terminal repeat and initiates HIV-1 transcription independently of Tat [21,31]. IRF-1 may act as the primary initiator of HIV-1 transcription before Tat and later synergize with Tat in amplifying HIV-1 replication [21]. It is reasonable to speculate that lowered baseline IRF-1 expression and reduced IRF-1 responsiveness may limit HIV-1 transcription and reduce viral replication at the initial stages of infection. That is, reduced IRF-1 expression and responsiveness in women with protective IRF-1 genotypes may partly protect them from infection through an inability to support the initial phases of HIV replication. This ‘natural’ protection may not have been apparent in previous studies showing that cells from HIV-resistant women can support HIV replication [11], as these studies and others like them used polyclonal activators such as phytohaemagglutinin to stimulate target cells, which may overwhelm any deleterious effects of IRF-1 in cells from these women.

This reduced initial replication could lead to a widened period allowing host immune responses to develop. This is supported by several non-human primate studies in which suboptimal viral inoculation can elicit protective mucosal and systemic responses [32]. Early control, or a reduction of HIV-1 replication before uncontrolled viral replication has been postulated as a key phase in blocking HIV-1 infection [33]. That protective IRF-1 genotypes are associated with reduced susceptibility but not prolonged HIV disease progression add further weight to this hypothesis. Further studies on the functional consequences of the IRF-1 polymorphisms in IRF-1 mRNA splicing and IRF-1-regulated immune responsiveness will provide a more comprehensive understanding of the mechanisms underlying this association. A more direct proof of IRF-1 protection against infection may come from identifying HIV-1 infection in unstimulated cells from subjects with altered IRF-1 genotypes. These studies are underway.

This study adds to the number of factors both genetic and immune mediated that associate with altered susceptibility to HIV-1. As a result of the complex nature of HIV susceptibility and immunity to HIV, it is likely that resistance is polygenic in nature, and that there is more than a single factor involved. Whenever possible, we conducted multivariate analysis to determine that the association between IRF-1 polymorphisms and the HIV-1-resistant phenotype was independent of previously identified HLA supertypes [13]. The interaction of these apparently independent genetic factors needs to be assessed in larger studies, and in other exposed uninfected cohorts. It is likely that all these different factors may provide alternative and perhaps complementary mechanisms protecting these women from infection. A previously identified polymorphism in the IL-4 promoter (−589C > T), which had been suggested to affect viral phenotype switch and HIV-1 disease progression [34,35], showed no correlation with the resistance phenotype (data not shown). We recently identified an association with the HIV-resistant phenotype and the expression of regulated upon activation: normal T-cell expressed/secreted in the genital tract. Although the numbers in the previous study were small (n = 10) further determination of both regulated upon activation: normal T-cell expressed/secreted levels in all HIV-resistant women and the association with IRF-1 genotypes are ongoing.

In conclusion, we have identified an association between polymorphisms in the IRF-1 gene and resistance to infection by HIV-1 in a Kenyan female sex worker cohort. Lowered IRF-1 expression may be the mechanism underlying this association. This study demonstrates that polymorphisms in an immunomodulatory and transcriptional regulatory gene were associated with altered susceptibility to HIV-1. This is the first report suggesting that altered host expression of a viral transcriptional regulator might contribute to the development of resistance to HIV-1. Clearly, these results are preliminary, and need to be confirmed in other study populations of exposed uninfected individuals, or more importantly, in a prospective, blinded manner to see if these polymorphisms affect HIV susceptibility directly.

Back to Top | Article Outline

Acknowledgements

The authors would like to thank Drs X. Mao, M. Luo, X. Yao, S. Ramdahin and L. Slaney, for technical support, as well as J. Waruk, L. McKinnon and S. Iqbal for critical review of the manuscript.

Sponsorship: This work was supported by grants from the National Institute of Health (RO1 A156980) and Canadian Institute of Health Research (CIHR, HOP43135). F.A.P. holds a tier I CIHR Canada Research Chair in resistance and susceptibility to infections. H.J. is a recipient of an International Center of Infectious Diseases (ICID)/CIHR national doctoral training award and Manitoba Health Research Council doctoral scholarship.

The first two authors contributed equally to this work.

Back to Top | Article Outline

References

1. Fowke KR, Nagelkerke NJ, Kimani J, Simonsen JN, Anzala AO, Bwayo JJ, et al. Resistance to HIV-1 infection among persistently seronegative prostitutes in Nairobi, Kenya. Lancet 1996; 348:1347–1351.

2. Beyrer C, Artenstein AW, Rugpao S, Stephens H, Van Cott TC, Robb ML, et al. Epidemiologic and biologic characterization of a cohort of human immunodeficiency virus type 1 highly exposed, persistently seronegative female sex workers in northern Thailand. Chiang Mai HEPS Working Group. J Infect Dis 1999; 179:59–67.

3. Kulkarni PS, Butera ST, Duerr AC. Resistance to HIV-1 infection: lessons learned from studies of highly exposed persistently seronegative (HEPS) individuals. AIDS Rev 2003; 5:87–103.

4. Louisirirotchanakul S, Liu H, Roongpisuthipong A, Nakayama EE, Takebe Y, Shioda T, et al. Genetic analysis of HIV-1 discordant couples in Thailand: association of CCR2 64I homozygosity with HIV-1-negative status. J Acquir Immune Defic Syndr 2002; 29:314–315.

5. Liu C, Carrington M, Kaslow RA, Gao X, Rinaldo CR, Jacobson LP, et al. Association of polymorphisms in human leukocyte antigen class I and transporter associated with antigen processing genes with resistance to human immunodeficiency virus type 1 infection. J Infect Dis 2003; 187:1404–1410.

6. Plummer FA, Ball TB, Kimani J, Fowke KR. Resistance to HIV-1 infection among highly exposed sex workers in Nairobi: what mediates protection and why does it develop? Immunol Lett 1999; 66:27–34.

7. Alimonti JB, Koesters SA, Kimani J, Matu L, Wachihi C, Plummer FA, Fowke KR. CD4+ T cell responses in HIV-exposed seronegative women are qualitatively distinct from those in HIV-infected women. J Infect Dis 2005; 191:20–24.

8. Rowland-Jones SL, Dong T, Fowke KR, Kimani J, Krausa P, Newell H, et al. Cytotoxic T cell responses to multiple conserved HIV epitopes in HIV-resistant prostitutes in Nairobi. J Clin Invest 1998; 102:1758–1765.

9. Kaul R, Trabattoni D, Bwayo JJ, Arienti D, Zagliani A, Mwangi FM, et al. HIV-1-specific mucosal IgA in a cohort of HIV-1-resistant Kenyan sex workers. AIDS 1999; 13:23–29.

10. Trivedi HN, Plummer FA, Anzala AO, Njagi E, Bwayo JJ, Ngugi EN, et al. Resistance to HIV-1 infection among African sex workers is associated with global hyporesponsiveness in interleukin 4 production. Faseb J 2001; 15:1795–1797.

11. Fowke KR, Dong T, Rowland-Jones SL, Oyugi J, Rutherford WJ, Kimani J, et al. HIV type 1 resistance in Kenyan sex workers is not associated with altered cellular susceptibility to HIV type 1 infection or enhanced beta-chemokine production. AIDS Res Hum Retroviruses 1998; 14:1521–1530.

12. Dunand VA, Ng CM, Wade JA, Bwayo J, Plummer FA, MacDonald KS. HLA-DR 52- and 51-associated DRB1 alleles in Kenya, east Africa. Tissue Antigens 1997; 49:397–402.

13. MacDonald KS, Fowke KR, Kimani J, Dunand VA, Nagelkerke NJ, Ball TB, et al. Influence of HLA supertypes on susceptibility and resistance to human immunodeficiency virus type 1 infection. J Infect Dis 2000; 181:1581–1589.

14. MacDonald KS, Matukas L, Embree JE, Fowke KR, Kimani J, Nagelkerke NJ, et al. Human leucocyte antigen supertypes and immune susceptibility to HIV-1, implications for vaccine design. Immunol Lett 2001; 79:151–157.

15. Bidwell J, Keen L, Gallagher G, Kimberly R, Huizinga T, McDermott MF, et al. Cytokine gene polymorphism in human disease: on-line databases. Genes Immun 1999; 1:3–19.

16. Bidwell J, Keen L, Gallagher G, Kimberly R, Huizinga T, McDermott MF, et al. Cytokine gene polymorphism in human disease: on-line databases, supplement 1. Genes Immun 2001; 2:61–70.

17. Haukim N, Bidwell JL, Smith AJ, Keen LJ, Gallagher G, Kimberly R, et al. Cytokine gene polymorphism in human disease: on-line databases, supplement 2. Genes Immun 2002; 3:313–330.

18. Hughes AE. Optimization of microsatellite analysis for genetic mapping. Genomics 1993; 15:433–434.

19. Kroger A, Koster M, Schroeder K, Hauser H, Mueller PP. Activities of IRF-1. J Interferon Cytokine Res 2002; 22:5–14.

20. Mamane Y, Heylbroeck C, Genin P, Algarte M, Servant MJ, LePage C, et al. Interferon regulatory factors: the next generation. Gene 1999; 237:1–14.

21. Sgarbanti M, Borsetti A, Moscufo N, Bellocchi MC, Ridolfi B, Nappi F, et al. Modulation of human immunodeficiency virus 1 replication by interferon regulatory factors. J Exp Med 2002; 195:1359–1370.

22. Battistini A, Marsili G, Sgarbanti M, Ensoli B, Hiscott J. IRF regulation of HIV-1 long terminal repeat activity. J Interferon Cytokine Res 2002; 22:27–37.

23. Ji H, Ball TB, Kimani J, Plummer FA. Novel interferon regulatory factor-1 polymorphisms in a Kenyan population revealed by complete gene sequencing. J Hum Genet 2004; 49:528–535.

24. Moore MJ. Gene expression. When the junk isn’t junk. Nature 1996; 379:402–403.

25. Herbert A. RNA editing, introns and evolution. Trends Genet 1996; 12:6–9.

26. Mattick JS. Introns: evolution and function. Curr Opin Genet Dev 1994; 4:823–831.

27. Lloyd C, Gunning P. Noncoding regions of the gamma-actin gene influence the impact of the gene on myoblast morphology. J Cell Biol 1993; 121:73–82.

28. Frederickson RM, Micheau MR, Iwamoto A, Miyamoto NG. 5′ flanking and first intron sequences of the human beta-actin gene required for efficient promoter activity. Nucl Acids Res 1989; 17:253–270.

29. Dirksen WP, Sun Q, Rottman FM. Multiple splicing signals control alternative intron retention of bovine growth hormone pre-mRNA. J Biol Chem 1995; 270:5346–5352.

30. Chabot B. Directing alternative splicing: cast and scenarios. Trends Genet 1996; 12:472–478.

31. Marsili G, Borsetti A, Sgarbanti M, Remoli AL, Ridolfi B, Stellacci E, et al. On the role of interferon regulatory factors in HIV-1 replication. Ann N Y Acad Sci 2003; 1010:29–42.

32. Miller CJ, McChesney MB, Lu X, Dailey PJ, Chutkowski C, Lu D, et al. Rhesus macaques previously infected with simian/human immunodeficiency virus are protected from vaginal challenge with pathogenic SIVmac239. J Virol 1997; 71:1911–1921.

33. Haase AT. Perils at mucosal front lines for HIV and SIV and their hosts. Nat Rev Immunol 2005; 5:783–792.

34. Nakayama EE, Hoshino Y, Xin X, Liu H, Goto M, Watanabe N, et al. Polymorphism in the interleukin-4 promoter affects acquisition of human immunodeficiency virus type 1 syncytium-inducing phenotype. J Virol 2000; 74:5452–5459.

35. Nakayama EE, Meyer L, Iwamoto A, Persoz A, Nagai Y, Rouzioux C, et al. Protective effect of interleukin-4-589T polymorphism on human immunodeficiency virus type 1 disease progression: relationship with virus load. J Infect Dis 2002; 185:1183–1186.

Cited By:

This article has been cited 21 time(s).

Clinical & Developmental Immunology
Natural Immunity to HIV: A Delicate Balance between Strength and Control
Poudrier, J; Thibodeau, V; Roger, M
Clinical & Developmental Immunology, (): -.
ARTN 875821
CrossRef
Plos One
Interferon Regulatory Factor 1 Polymorphisms Previously Associated with Reduced HIV Susceptibility Have No Effect on HIV Disease Progression
Sivro, A; McKinnon, LR; Ji, HZ; Kimani, J; Jaoko, W; Plummer, FA; Su, RC; Ball, TB
Plos One, 8(6): -.
ARTN e66253
CrossRef
Proceedings of the National Academy of Sciences of the United States of America
Phenotypic properties of transmitted founder HIV-1
Parrish, NF; Gao, F; Li, H; Giorgi, EE; Barbian, HJ; Parrish, EH; Zajic, L; Iyer, SS; Decker, JM; Kumar, A; Hora, B; Berg, A; Cai, FP; Hopper, J; Denny, TN; Ding, HT; Ochsenbauer, C; Kappes, JC; Galimidi, RP; West, AP; Bjorkman, PJ; Wilen, CB; Doms, RW; O'Brien, M; Bhardwaj, N; Borrow, P; Haynes, BF; Muldoon, M; Theiler, JP; Korber, B; Shaw, GM; Hahn, BH
Proceedings of the National Academy of Sciences of the United States of America, 110(): 6626-6633.
10.1073/pnas.1304288110
CrossRef
Plos Pathogens
Association Study of Common Genetic Variants and HIV-1 Acquisition in 6,300 Infected Cases and 7,200 Controls
McLaren, PJ; Coulonges, C; Ripke, S; van den Berg, L; Buchbinder, S; Carrington, M; Cossarizza, A; Dalmau, J; Deeks, SG; Delaneau, O; De Luca, A; Goedert, JJ; Haas, D; Herbeck, JT; Kathiresan, S; Kirk, GD; Lambotte, O; Luo, M; Mallal, S; van Manen, D; Martinez-Picado, J; Meyer, L; Miro, JM; Mullins, JI; Obel, N; O'Brien, SJ; Pereyra, F; Plummer, FA; Poli, G; Qi, Y; Rucart, P; Sandhu, MS; Shea, PR; Schuitemaker, H; Theodorou, I; Vannberg, F; Veldink, J; Walker, BD; Weintrob, A; Winkler, CA; Wolinsky, S; Telenti, A; Goldstein, DB; de Bakker, PIW; Zagury, JF; Fellay, J
Plos Pathogens, 9(7): -.
ARTN e1003515
CrossRef
Vaccine
Immunogenetic basis of HIV-1 infection., transmission and disease progression
Singh, P; Kaur, G; Sharma, G; Mehra, NK
Vaccine, 26(): 2966-2980.
10.1016/j.vaccine.2008.01.012
CrossRef
Critical Reviews in Immunology
Genital and Oral Mucosal Immune Response Against HIV-1 in Exposed Uninfected Individuals
Hasselrot, K
Critical Reviews in Immunology, 29(5): 369-377.

Terapevticheskii Arkhiv
Hiv Infection and Human Genetics
Bobkova, MR
Terapevticheskii Arkhiv, 81(): 78-84.

AIDS Research and Human Retroviruses
Impaired Viral Entry Cannot Explain Reduced CD4(+) T Cell Susceptibility to HIV Type 1 in Certain Highly Exposed Individuals
Speelmon, EC; Livingston-Rosanoff, D; Desbien, AL; Lee, J; Wick, WD; Hladik, F; McElrath, MJ
AIDS Research and Human Retroviruses, 24(): 1415-1427.
10.1089/aid.2007.0256
CrossRef
Journal of Interferon and Cytokine Research
Multiple sclerosis and hepatitis C virus infection are associated with single nucleotide polymorphisms in interferon pathway genes
Fortunato, G; Calcagno, G; Bresciamorra, V; Salvatore, E; Filla, A; Capone, S; Liguori, R; Borelli, S; Gentile, I; Borrelli, F; Borgia, G; Sacchetti, L
Journal of Interferon and Cytokine Research, 28(3): 141-152.
10.1089/jir.2007.0049
CrossRef
Annual Review of Genomics and Human Genetics
African genetic diversity: Implications for human demographic history, modern human origins, and complex disease mapping
Campbell, MC; Tishkoff, SA
Annual Review of Genomics and Human Genetics, 9(): 403-433.
10.1146/annurev.genom.9.081307.164258
CrossRef
Journal of Internal Medicine
Genetic correlates of protection against HIV infection: the ally within
Piacentini, L; Biasin, M; Fenizia, C; Clerici, M
Journal of Internal Medicine, 265(1): 110-124.
10.1111/j.1365-2796.2008.02041.x
CrossRef
Journal of Internal Medicine
Introduction: Back to basics: mucosal immunity and novel HIV vaccine concepts
Broliden, K; Haase, AT; Ahuja, SK; Shearer, GM; Andersson, J
Journal of Internal Medicine, 265(1): 5-17.
10.1111/j.1365-2796.2008.02053.x
CrossRef
Genes and Immunity
Interferon regulatory factor-1 polymorphisms are associated with the control of Plasmodium falciparum infection
Mangano, VD; Luoni, G; Rockett, KA; Sirima, BS; Konate, A; Forton, J; Clark, TG; Bancone, G; Akha, ES; Kwiatkowski, DP; Modiano, D
Genes and Immunity, 9(2): 122-129.
10.1038/sj.gene.6364456
CrossRef
AIDS Research and Human Retroviruses
The Relationship Between Antibody to R7V and Progression of HIV Type 1 Infection
Margolick, JB; Castro, JMD; Sanchez, A; Gemrot, F; Phair, JP; Jamieson, BD; Rinaldo, CR; Jacobson, LP
AIDS Research and Human Retroviruses, 26(4): 389-394.
10.1089/aid.2009.0101
CrossRef
Trends in Genetics
Host genes associated with HIV/AIDS: advances in gene discovery
An, P; Winkler, CA
Trends in Genetics, 26(3): 119-131.
10.1016/j.tig.2010.01.002
CrossRef
Scandinavian Journal of Infectious Diseases
Reduced HIV-1 long terminal repeat transcription in subjects with protective interferon regulatory factor-1 genotype: A potential mechanism mediating resistance to infection by HIV-1
Ji, HZ; Ball, TB; Ao, ZJ; Kimani, J; Yao, XJ; Plummer, FA
Scandinavian Journal of Infectious Diseases, 42(5): 389-394.
10.3109/00365540903496536
CrossRef
Human Genetics
Genetic studies of African populations: an overview on disease susceptibility and response to vaccines and therapeutics
Sirugo, G; Hennig, BJ; Adeyemo, AA; Matimba, A; Newport, MJ; Ibrahim, ME; Ryckman, KK; Tacconelli, A; Mariani-Costantini, R; Novelli, G; Soodyall, H; Rotimi, CN; Ramesar, RS; Tishkoff, SA; Williams, SM
Human Genetics, 123(6): 557-598.
10.1007/s00439-008-0511-y
CrossRef
Journal of Medical Virology
TLR3 Gene Polymorphisms and Liver Disease Manifestations in Chronic Hepatitis C
Askar, E; Bregadze, R; Mertens, J; Schweyer, S; Rosenberger, A; Ramadori, G; Mihm, S
Journal of Medical Virology, 81(7): 1204-1211.
10.1002/jmv.21491
CrossRef
AIDS
Heterogeneity in host HIV susceptibility as a potential contributor to recent HIV prevalence declines in Africa
Nagelkerke, NJ; de Vlas, SJ; Jha, P; Luo, M; Plummer, FA; Kaul, R
AIDS, 23(1): 125-130.
10.1097/QAD.0b013e3283177f20
PDF (311) | CrossRef
AIDS
The ‘immunologic advantage’ of HIV-exposed seronegative individuals
for the ESN Study Group, ; Miyazawa, M; Lopalco, L; Mazzotta, F; Caputo, SL; Veas, F; Clerici, M
AIDS, 23(2): 161-175.
10.1097/QAD.0b013e3283196a80
PDF (293) | CrossRef
AIDS
HIV viral set point and host immune control in individuals with HIV-specific CD8+ T-cell responses prior to HIV acquisition
Kaul, R; MacDonald, KS; Nagelkerke, NJ; Kimani, J; Fowke, K; Ball, TB; Luo, M; Kariri, A; Jaoko, W; Moses, S; Rowland-Jones, S; Plummer, FA
AIDS, 24(10): 1449-1454.
10.1097/QAD.0b013e3283391d40
PDF (174) | CrossRef
Back to Top | Article Outline
Keywords:

Gene polymorphism; IL-4 gene cluster; interferon regulatory factor 1; resistance to infection by HIV-1

© 2007 Lippincott Williams & Wilkins, Inc.

Login

Search for Similar Articles
You may search for similar articles that contain these same keywords or you may modify the keyword list to augment your search.