Skip Navigation LinksHome > April 23, 2007 - Volume 21 - Issue 7 > Primary genotypic resistance of HIV-1 to the maturation inhi...
AIDS:
doi: 10.1097/QAD.0b013e3280b079d9
Research Letters

Primary genotypic resistance of HIV-1 to the maturation inhibitor PA-457 in protease inhibitor-experienced patients

Malet, Isabellea; Wirden, Marca; Derache, Annea; Simon, Anneb; Katlama, Christinec,d; Calvez, Vincenta; Marcelin, Anne-Genevièvea

Free Access
Article Outline
Collapse Box

Author Information

aLaboratoire de Virologie, Université Pierre et Marie Curie (Paris 6), France

bService de Médecine Interne, France

cService des Maladies Infectieuses, Hôpital Pitié-Salpêtrière, Assistance Publique-Hôpitaux de Paris, Paris, France

dINSERM U720, Université Pierre et Marie Curie (Paris 6), Paris, France.

Received 7 December, 2006

Accepted 15 December, 2006

Collapse Box

Abstract

Sequences from 82 protease inhibitors (PI)-experienced patients were analysed for the presence of previously described in-vitro resistance mutations to PA-457 located in the C-terminal capside (H226Y, L231F, L231M) and in the N-terminal SP1 (A1V, A3T, A3V) within the CA-SP1 boundary domain. Overall, the CA-SP1 cleavage site was highly conserved in PI pre-treated patients and only one patient showed an L231M mutation. The impact of this mutation should be further addressed in vivo.

The maturation inhibitor PA-457 (3-O-{3′,3′-dimethylsuccinyl}-betulinic acid) represents a new substance class for the treatment of HIV infection. It is a small molecule inhibitor of late-stage HIV-1 replication cycle that acts by specifically disrupting the conversion of the Gag capside precursor protein (p25CA-SP1) to mature capside protein (p24CA) resulting in the release of immature, non-infectious virus particles [1]. In vitro, serial passage experiments identified six single amino acid substitutions that independently confer PA-457 resistance: three at or near the C terminus of capside (CA-H226Y, L231F, and L231M) and three at the first and third residues of SP1 (SP1-A1V, A3T, and A3V) [2]. In vivo, preliminary results in eight HIV-1-infected patients treated by PA-457 in monotherapy (200 mg once a day) for 10 days reported an HIV-1 plasma viral load decrease of −1.1 log10 copies/ml [3].

In antiretroviral-naive patients there is a limited degree of natural polymorphism at the CA-SP1 cleavage site in subtype B HIV-1 because only one position has been reported to be polymorphic, V362I, which is present in 7% of naive patients [4].

In protease inhibitor (PI)-experienced patients, the resistance to PI follows an accumulation of mutations in the viral protease, mostly located in the active site of the enzyme and therefore having impact on protease activity [5]. It has thus been shown that compensatory Gag cleavage site mutations allow an increase of the enzymatic activity and a partial recovery in producing mature infectious virions [6,7]. These mutations are usually described in the two sites NC/p1 and p1/p6 [8], and even outside of the Gag cleavage site [9]. Currently, there is a lack of information on the possibility of mutations in the CA-SP1 cleavage site in PI-experienced patients. As mutations in this site, selected in vitro in serial passage experiments with PA-457, could impair the activity of this drug, it is important to know whether primary resistance to PA-457 can be detected in patients previously exposed to PI before the initiation of PA-457.

In this report, sequences of the entire CA-SP1 boundary domain (GHKARVLAEAMSQVTNPATIM) from 82 PI-experienced patients infected with subtype B HIV-1 strains were analysed for the presence of previously described in-vitro mutations linked to resistance to PA-457.

At the time of analysis, patients were treated by at least two nucleoside reverse transcriptase inhibitors and one PI, and harboured virological failure with a mean HIV-1 plasma viral load of 4.44 ± 0.75 log10 copies/ml (mean ± standard deviation). The mean duration of exposure to antiretroviral therapy was 46 ± 36 months and to PI was 24 ± 15 months. According to the 2006 International AIDS Society – USA panel (http://www.iasusa.org), the baseline median number of major and minor PI mutations was two (zero to six) and six (one to 12), respectively.

Viral RNA was extracted from plasma samples and the reverse transcriptase–polymerase chain reaction followed by a second round polymerase chain reaction were performed as previously described [10]. The following primer pairs were used: [nucleotides (nt) 1585–1610] 5′–ATAATCCTGGGATTAAATAAAATAGT–3′ and (nt 2093–2114) 5′–TTGTAGGAAGGCCAGATCTTCC–3′ as outer primers, and (nt 1747–1766) 5′–ACCTTGTTGGTCCAAAATGC–3′ and (nt 2023–2047) 5′–CTTCCTTTCCACATTTCCAACAGCC–3′ as inner primers. The 301 base pair region covering the CA-SP1 boundary sequence was purified using Amicon Microcon-100 (Millipore Corporation, Billerica, Massachusetts, USA) and sequenced using a cycle sequencing reaction with the Big Dye terminator kit (Applied Biosystems, Foster City, California, USA). The sequences were aligned using Sequence Navigator software.

Twenty-one amino acids of the CA-SP1 boundary domain from the 82 sequences were compared with the HxB2 reference sequence (Table 1). The sequence analysis showed a total conservation for nine out of the 21 amino acid residues analysed (43% of conservation). The conserved positions are particularly located in the C-terminal capside (H226, K227, A228, R229) and in the N-terminal half of SP1 (A1, E2, A3, M4). The M14 position, also highly conserved, is located in the extremity of the C-terminal of SP1 that is separated from the two other conserved regions. On the other hand, a high degree of variability has been observed in the C-terminal half of SP1 (Q6 to I13). In the conserved region, among the 82 sequences analysed, V230I has been identified in eight patients (10%) and a particular mutation, L231M, in one patient. The past history of treatment of this patient who harboured the L231M mutation was no different from the other patients studied.

Table 1
Table 1
Image Tools

The results of this study show that the CA-SP1 cleavage site seems to be highly conserved in PI-pretreated patients. As determinants of PA-457 activity are limited mostly to C-terminal capside and the N-terminal half of SP1 [11], these results are comforting for the use of this drug in PI-pretreated patients. The V230I mutation, located in the C-terminal capside, is present in 10% of PI-pretreated patients, which is similar to what has previously been described in naive patients. Although CA-SP1 resistance mutations to PA-457, such as L231M, could be observed in one patient previously exposed to PI, this seems to be a rare event. The L231M mutation has been identified in in-vitro drug-resistance selection studies with PA-457 and confers some level of resistance to PA-457, suggesting that this residue plays a critical role in mediating the effect of the compound on CA-SP1 processing. The impact of this mutation should, however, be further addressed in vivo.

Moreover, HIV-1 subtypes are geographically distributed, with subtype B predominating in north America and Europe. Consequently, the bulk of studies on the biological basis of drug susceptibility have been undertaken on subtype B viruses. The most prevalent viruses worldwide are, however, non-B, and the prevalence of non-B viruses is increasing in Europe [12,13]. Genetic subtypes may influence drug susceptibility, as well as the likelihood of developing drug resistance-associated mutations. Currently, there is a lack of information on primary resistance of HIV-1 to PA-457 in different HIV-1 subtypes, suggesting the need for such studies.

Back to Top | Article Outline

References

1. Zhou J, Yuan X, Dismuke D, Forshey BM, Lundquist C, Lee KH, et al. Small-molecule inhibition of human immunodeficiency virus type 1 replication by specific targeting of the final step of virion maturation. J Virol 2004; 78:922–929.

2. Adamson CS, Ablan SD, Boeras I, Goila-Gaur R, Soheilian F, Nagashima K, et al. In vitro resistance to the human immunodeficiency virus type 1 maturation inhibitor PA-457 (Bevirimat). J Virol 2006; 80:10957–10971.

3. Smith P, Beatty G, Jacobson J, Lalezari J, Eron J, Pollard R, et al. Pharmacokinetics/pharmacodynamics of PA-457 in a 10-day multiple dose monotherapy trial in HIV-infected patients. In:13th Conference on Retroviruses and Opportunistic Infections. Denver, CO, USA, 5–8 February 2006 [Abstract 52].

4. De Oliveira T, Engelbrecht S, Janse van Rensburg E, Gordon M, Bishop K, zur Megede J, et al. Variability at human immunodeficiency virus type 1 subtype C protease cleavage sites: an indication of viral fitness? J Virol 2003; 77:9422–9430.

5. Wlodawer A, Erickson JW. Structure-based inhibitors of HIV-1 protease. Annu Rev Biochem 1993; 62:543–585.

6. Doyon L, Croteau G, Thibeault D, Poulin F, Pilote L, Lamarre D. Second locus involved in human immunodeficiency virus type 1 resistance to protease inhibitors. J Virol 1996; 70:3763–3769.

7. Zhang YM, Imamichi H, Imamichi T, Lane HC, Falloon J, Vasudevachari MB, Salzman NP. Drug resistance during indinavir therapy is caused by mutations in the protease gene and in its Gag substrate cleavage sites. J Virol 1997; 71:6662–6670.

8. Feher A, Weber IT, Bagossi P, Boross P, Mahalingam B, Louis JM, et al. Effect of sequence polymorphism and drug resistance on two HIV-1 Gag processing sites. Eur J Biochem 2002; 269:4114–4120.

9. Myint L, Matsuda M, Matsuda Z, Yokomaku Y, Chiba T, Okano A, et al. Gag non-cleavage site mutations contribute to full recovery of viral fitness in protease inhibitor-resistant human immunodeficiency virus type 1. Antimicrob Agents Chemother 2004; 48:444–452.

10. Malet I, Roquebert B, Dalban C, Wirden M, Amellal B, Agher R, et al. Association of Gag cleavage sites to protease mutations and to virological response in HIV-1 treated patients. J Infect 2006; e-pub ahead of print, 25 July 2006.

11. Li F, Zoumplis D, Matallana C, Kilgore NR, Reddick M, Yunus AS, et al. Determinants of activity of the HIV-1 maturation inhibitor PA-457. Virology 2006; 356:217–224.

12. Hemelaar J, Gouws E, Ghys PD, Osmanov S. Global and regional distribution of HIV-1 genetic subtypes and recombinants in 2004. AIDS 2006; 20:W13–W23.

13. Wensing AM, van de Vijver DA, Angarano G, Asjo B, Balotta C, Boeri E, et al. Prevalence of drug-resistant HIV-1 variants in untreated individuals in Europe: implications for clinical management. J Infect Dis 2005; 192:958–966.

Cited By:

This article has been cited 14 time(s).

New Phytologist
Bioengineering of plant (tri)terpenoids: from metabolic engineering of plants to synthetic biology invivo and invitro
Moses, T; Pollier, J; Thevelein, JM; Goossens, A
New Phytologist, 200(1): 27-43.
10.1111/nph.12325
CrossRef
AIDS Reviews
Maturation inhibitors: a new therapeutic class targets the virus structure
Salzwedel, K; Martin, DE; Sakalian, M
AIDS Reviews, 9(3): 162-172.

Journal of Virology
A Single Amino Acid Substitution in a Segment of the CA Protein within Gag That Has Similarity to Human Immunodeficiency Virus Type 1 Blocks Infectivity of a Human Endogenous Retrovirus K Provirus in the Human Genome
Heslin, DJ; Murcia, P; Arnaud, F; Van Doorslaer, K; Palmarini, M; Lenz, J
Journal of Virology, 83(2): 1105-1114.
10.1128/JVI.01439-08
CrossRef
Antimicrobial Agents and Chemotherapy
Phenotypic Susceptibility to Bevirimat in Isolates from HIV-1-Infected Patients without Prior Exposure to Bevirimat
Margot, NA; Gibbs, CS; Miller, MD
Antimicrobial Agents and Chemotherapy, 54(6): 2345-2353.
10.1128/AAC.01784-09
CrossRef
Antiviral Research
Novel approaches to inhibiting HIV-1 replication
Adamson, CS; Freed, EO
Antiviral Research, 85(1): 119-141.
10.1016/j.antiviral.2009.09.009
CrossRef
Antiviral Research
Molecular basis of human immunodeficiency virus drug resistance: An update
Menendez-Arias, L
Antiviral Research, 85(1): 210-231.
10.1016/j.antiviral.2009.07.006
CrossRef
Drugs of the Future
Hiv-1 Maturation Inhibitors: An Update
Dang, Z; Huang, L; Chen, CH
Drugs of the Future, 34(): 797-802.
10.1358/dof.2009.34.10.1428207
CrossRef
Journal of Virology
Impact of Human Immunodeficiency Virus Type 1 Resistance to Protease Inhibitors on Evolution of Resistance to the Maturation Inhibitor Bevirimat (PA-457)
Adamson, CS; Waki, K; Ablan, SD; Salzwedel, K; Freed, EO
Journal of Virology, 83(): 4884-4894.
10.1128/JVI.02659-08
CrossRef
Antiviral Therapy
The maturation inhibitor bevirimat (PA-457) can be active in patients carrying HIV type-1 non-B subtypes and recombinants
Yebra, G; Holguin, A
Antiviral Therapy, 13(8): 1083-1085.

Expert Opinion on Therapeutic Targets
Virus maturation as a new HIV-1 therapeutic target
Adamson, CS; Salzwedel, K; Freed, EO
Expert Opinion on Therapeutic Targets, 13(8): 895-908.
10.1517/14728220903039714
CrossRef
Retrovirology
Polymorphisms in Gag spacer peptide 1 confer varying levels of resistance to the HIV-1 maturation inhibitor bevirimat
Adamson, CS; Sakalian, M; Salzwedel, K; Freed, EO
Retrovirology, 7(): -.
ARTN 36
CrossRef
AIDS
Can the further clinical development of bevirimat be justified?
Wainberg, MA; Albert, J
AIDS, 24(5): 773-774.
10.1097/QAD.0b013e328331c83b
PDF (244) | CrossRef
AIDS
High prevalence of bevirimat resistance mutations in protease inhibitor-resistant HIV isolates
Verheyen, J; Verhofstede, C; Knops, E; Vandekerckhove, L; Fun, A; Brunen, D; Dauwe, K; Wensing, AM; Pfister, H; Kaiser, R; Nijhuis, M
AIDS, 24(5): 669-673.
10.1097/QAD.0b013e32833160fa
PDF (317) | CrossRef
AIDS
High prevalence of natural polymorphisms in Gag (CA-SP1) associated with reduced response to Bevirimat, an HIV-1 maturation inhibitor
Seclén, E; González, M; Corral, A; de Mendoza, C; Soriano, V; Poveda, E
AIDS, 24(3): 467-469.
10.1097/QAD.0b013e328335ce07
PDF (356) | CrossRef
Back to Top | Article Outline

© 2007 Lippincott Williams & Wilkins, Inc.

Login