Skip Navigation LinksHome > March 30, 2007 - Volume 21 - Issue 6 > Nearly identical strains of human herpesvirus 8 in couples d...
AIDS:
doi: 10.1097/QAD.0b013e328031f450
Research Letters

Nearly identical strains of human herpesvirus 8 in couples discordant for Kaposi's sarcoma

Kouri, Viviana; Marini, Alessandrab; Nambiar, Sandeepb; Rodriguez, Maria Ea; Capo, Virginiaa; Resik, Soniaa; Mantecon, Beatriza; Martinez, Ariela; Köhler-Hansner, Karin Jc; Hengge, Ulrich Rb

Free Access
Article Outline
Collapse Box

Author Information

aInstituto de Medicina Tropical ‘Pedro Kouri’, Ciudad de La Habana, Cuba, Germany

bDepartment of Dermatology, Heinrich Heine University, Düsseldorf, Germany

cJoachim Kuhlmann AIDS Foundation, Essen, Germany.

Received 17 October, 2006

Revised 15 November, 2006

Accepted 4 December, 2006

Collapse Box

Abstract

Transmission of human herpesvirus 8 (HHV-8) may occur through various routes including breastfeeding and sexual intercourse. We attempted to detect HHV-8 infection in nine HIV-positive couples discordant for Kaposi's sarcoma who maintained a monogamous sexual relationship for at least one year. By quantitative real-time polymerase chain reaction and HHV-8 genotyping we provide strong evidence for the sexual transmission of HHV-8 in this unique cohort.

Human herpesvirus 8 (HHV-8), also known as Kaposi's sarcoma (KS)-associated herpesvirus, has been associated with all forms of KS [1]. The predominant method of transmission in homosexual men is thought to occur via the sexual route although this has not been formally confirmed [2,3]. Very recently, Bagasra et al. [4] have shown HHV-8 infection of spermatozoa and mononuclear cells in the sperm. The detection of HHV-8 DNA in peripheral blood mononuclear cells (PBMC) from HIV-1-infected individuals is associated with an increased risk of the subsequent development of KS and with an advanced clinical stage [5,6]. Earlier studies used qualitative or semiquantitative estimates of the HHV-8 load [7], whereas more recent quantitative assays were based on open reading frame (ORF) 26, ORF 73, and ORF 65 [8–10]. Overall, the frequency of detection of HHV-8 DNA in PBMC among KS patients ranged from 42 to 84% [1,5].

Viral characteristics (e.g. transmission, viral load and genotype) have, however, not been systematically analysed in a cohort of sexual partners who were discordant for KS. We attempted to quantify and genotype HHV-8 in the PBMC of KS patients and their disclosed asymptomatic sexual contacts using a new real-time polymerase chain reaction (PCR) assay based on the conserved ORF K1 region [11,12].

Nine patients with histopathologically confirmed KS disclosed nine HIV-positive individuals (without KS; mean CD4 cell count 465 cells/μl; mean HIV viral load 1647 copies/ml) with whom they had practised monogamous sexual intercourse for at least 12 months (Table 1). The mean age was 37 years (Table 1). Seven out of nine asymptomatic patients were on HAART consisting of two different nucleoside inhibitors (for most patients zidovudine and lamivudine) and indinavir; likewise, seven out of nine patients received HAART in the KS-bearing cohort. Five HIV-1-seronegative laboratory workers (three women and two men; age range 27–42 years) were included as negative controls. Genomic DNA from the BC3 cell line (kindly provided by Dr Ornella Flore, Department of Microbiology, New York University Medical School) known to contain 40 copies of HHV-8 was used as a positive control.

Table 1
Table 1
Image Tools

Genomic DNA was extracted from Ficoll–Hypaque (Amersham Biosciences, Piscataway, New Jersey, USA) separated PBMC using the QIAmp DNA extraction kit (Qiagen, Valencia, California, USA), following the manufacturer's protocol. The amount of HHV-8 DNA present in PBMC and tissue specimens was determined by real-time PCR amplification (7300 real-time PCR system; Applied Biosystems, Foster City, California, USA) using the following set of primers: forward (5′ACCAAACGGACGAAATGATCTAA3′) and reverse (5′CAGTTTGGTTCATCAGCGTAAAATT3′) and the fluorogenic (FAM) Taqman probe (5′CGTGTCACAAACTAAA3′) to detect a 101 base pair (bp) amplicon in the HHV-8 ORF K1 conserved region (nucleotides 386–486) [12]. Cycling parameters were 2 min at 50°C, 10 min at 95°C, followed by 50 cycles of 15 s at 95°C and 1 min at 60°C. The samples were analysed in triplicate. For quantification, standard curves from the BC3 cell line (gDNA extracted from culture supernatant) were prepared for both the target and the human β-globin DNA in a series of twofold dilutions. For each sample, the amount of target and control DNA was determined from the respective standard curve and normalized. The log input amount was calculated according to the formula:

Equation (Uncited)
Equation (Uncited)
Image Tools

where b is the y-intercept of the standard curve, and m is the slope of the standard curve.

For sequencing, the Beckman Coulter automatic sequencer (CEQ 8000 genetic analysis system; Beckman Coulter, Fullerton, California, USA) was used. DNA sequences were aligned using CLUSTAL X version 1.81. Neighbour-joining analysis of aligned sequences was carried out using the MEGA version 2 software and compared with reference strains.

HHV-8 seroprevalence in the asymptomatic sexual contacts of Cuban KS patients was analysed using LANA (ORF 73) antibodies [13,14], real-time PCR and genotyping. Six of the nine (66.7%) asymptomatic sexual contacts of KS patients were LANA positive by immunofluorescence at the time of sampling, similar to previous results in a Cuban seroprevalence study (Table 1) [13]. When compared with their stored routine blood samples from one to 3 years before the study, only one of eight (12.5%) was LANA positive, thus probably indicating recent seroconversion. For comparison, seven out of nine (77.8%) KS patients had detectable LANA antibodies.

The quantitative real-time assay was based on the amplification of a unique 101 bp amplicon in the HHV-8 ORF K1 conserved unique region from nucleotides 386 to 486 [15]. The ORF K1 primers were selected because previous primers designed from other conserved regions have shown poor efficiency of HHV-8 detection in asymptomatic patients [8–10]. HHV-8 quantification in the human BC3 cell line proved to be linear over a wide range (from 2 to 13 000 copies; data not shown). The detection rate was 100% when the copy number exceeded 10 copies. The intra-assay variation was below 4% and the inter-assay variation was 3% (data not shown). Seven out of eight (87.5%) PBMC specimens from asymptomatic sexual contacts were positive by real-time PCR, whereas six out of eight (75%) of these samples were positive by LANA immunofluorescence (Table 1). Quantification of HHV-8 from the PBMC of asymptomatic sexual contacts revealed a mean of 880 copies (median 23). Not surprisingly, three cases (i.e. C1, C10 and C14) with undetectable HIV loads and a CD4 cell count of more than 400 cells/μl showed low HHV-8 copy numbers (Table 1).

HHV-8 genotype analysis was based on the variable region in the ORF K1 (nucleotides 117–738; Fig. 1) [16]. Seven out of eight (87.5%) PBMC DNA specimens of asymptomatic sexual contacts showed HHV-8 infection, as demonstrated by nested PCR amplification of the ORF K1 sequence, whereas one sample (C14) was below the cutoff. Most interestingly, all HHV-8 strains of asymptomatic sexual contacts and their disclosed KS-positive sexual partners belonged to the identical genotype, with only exceptional amino acid substitutions being present (Fig. 1) [15,16]. Given the reported diversity of HHV-8 genotypes [12], random infection with the respective strains during the study period seems unlikely. No correlation of virus genotype and ethnicity or sexual preference (i.e. homosexual or bisexual) was found.

Fig. 1
Fig. 1
Image Tools

In summary, we report the detection of HHV-8 DNA in 87.5% of asymptomatic sexual contacts who entertained a sexual relationship with a KS patient. The real-time PCR assay based on ORF K1 showed comparable sensitivity and specificity with other real-time PCR assays using alternative conserved HHV-8 genes [8–10]. Whereas the data not only show a high percentage of HHV-8 detection in asymptomatic sexual contacts, they also showed, without a single exception, highly homologous matching HHV-8 genotypes such as found in the indicator patients. As a limitation, these individuals could have been infected before engagement in a sexual relationship with the KS-bearing patients, although LANA testing before enrollment was negative for most patients. The presence of the identical genotype (i.e. A5 and C) besides the most prevalent type A3 seems highly unlikely. The high degree of homology within the pairs analysed engaging in a stable sexual relationship and the seroconversion data of banked sera from asymptomatic patients thus strongly suggest sexual (anogenital or orogenital) transmission of HHV-8 in this unique cohort with disclosed sexual partners.

Sponsorship: This study was supported by a grant from the Joachim Kuhlmann AIDS Foundation, Essen, Germany.

Back to Top | Article Outline

References

1. Hengge UR, Ruzicka T, Tyring SK, Stuschke M, Roggendorf M, Schwartz RA, et al. Update on Kaposi's sarcoma and other HHV8 associated diseases. Part 1: Epidemiology, environmental predispositions, clinical manifestations, and therapy. Lancet Infect Dis 2002; 25:281–292.

2. Challine D, Roudot-Thoraval F, Sarah T, Laperche L, Boisson B, Mauberquez S, et al. Seroprevalence of human herpes virus 8 antibody in populations at high or low risk of transfusion, graft, or sexual transmission of viruses. Transfusion 2001; 41:1120–1125.

3. Henke-Gendo C, Schulz TF. Transmission and disease association of Kaposi's sarcoma-associated herpesvirus: recent developments. Curr Opin Infect Dis 2004; 171:53–57.

4. Bagasra O, Patel D, Bobroski L, Abbasi JA, Bagasra AU, Baidouri H, et al. Localization of human herpes-virus type 8 in human sperms by in situ PCR. J Mol Histol 2006; 2:1–12.

5. Whitby D, Howard MR, Tenant-Flowers M, Brink NS, Copas A, Boshoff C, et al. Detection of Kaposi's sarcoma-associated herpesvirus KSHV in peripheral blood of HIV-infected individuals predicts progression to Kaposi's sarcoma. Lancet 1995; 364:799–802.

6. Tedeschi R, Enbom M, Bidoli E, Linde A, De Paoli P, Dillner J. Viral load of human herpesvirus 8 in peripheral blood of human immunodeficiency virus-infected patients with Kaposi's sarcoma. J Clin Microbiol 2001; 39:4269–4273.

7. Curreli F, Robles MA, Friedman-Kien AE, Flore O. Detection and quantitation of Kaposi's sarcoma-associated herpesvirus KSHV by a single competitive-quantitative polymerase chain reaction. J Virol Methods 2003; 107:261–267.

8. Boivin G, Cote S, Cloutier N, Abed Y, Maguigad M, Routy JP. Quantification of human herpesvirus 8 by real-time PCR in blood fractions of AIDS patients with Kaposi's sarcoma and multicentric Castleman's disease. J Med Virol 2002; 68:399–403.

9. Asahi-Ozaki Y, Sato Y, Kanno T, Sata T, Katano H. Quantitative analysis of Kaposi sarcoma-associated herpesvirus (KSHV) in KSHV-associated diseases. J Infect Dis 2006; 193:773–782.

10. Polstra AM, Van Den Burg R, Goudsmit J, Cornelissen M. Human herpesvirus 8 load in matched serum and plasma samples of patients with AIDS-associated Kaposi's sarcoma. J Clin Microbiol 2003; 41:5488–5491.

11. Kouri V, Liang X, Rodriguez ME, Capo V, Resik S, Barrios J, et al. Molecular epidemiology and KSHV K1 subtypes in Cuban AIDS-KS population. AIDS 2005; 19:984–987.

12. Zong J, Ciufo DM, Viscidi R, Alagiozoglou L, Tyring S, Rady P, et al. Genotypic analysis at multiple loci across Kaposi's sarcoma herpesvirus KSHV DNA molecules: clustering patterns, novel variants and chimerism. J Clin Virol 2002; 233:119–148.

13. Kouri V, Eng SM, Rodriguez ME, Resik S, Orraca O, Moore PS, et al. Seroprevalence of Kaposi's sarcoma-associated herpesvirus in various populations in Cuba. Rev Panam Salud Publica 2004; 15:320–325.

14. Gao SJ, Kingsley L, Li M, Zheng W, Parravicini C, Ziegler J, et al. KSHV antibodies among Americans, Italians, and Ugandans with and without Kaposi's sarcoma. Nat Med 1996; 2:925–928.

15. Zong JC, Ciufo DM, Alcendor DJ, Wan X, Nicholas J, Browning PJ, et al. High-level variability in the ORF-K1 membrane protein gene at the left end of the Kaposi's sarcoma-associated herpesvirus genome defines four major virus subtypes and multiple variants or clades in different human populations. J Virol 1999; 73:4156–4170.

16. Kouri V, Marini A, Doroudi R, Nambiar S, Rodriguez ME, Capo V, et al. Molecular epidemiology of Kaposi's sarcoma herpesvirus (KSHV) in Cuban and German patients with Kaposi's sarcoma (KS) and asymptomatic sexual contacts. Virology 2005; 337:297–303.

Cited By:

This article has been cited 2 time(s).

Hautarzt
Human herpesvirus 8 (HHV-8) and Kaposi sarcoma
Lebbe, C
Hautarzt, 59(1): 18-25.
10.1007/s00105-007-1445-3
CrossRef
AIDS
First report of Kaposi's sarcoma-associated herpesvirus DNA sequences from Cuban Kaposi's sarcoma patients without HIV infection
Kouri, V; Martinez, PA; Acosta, B; Rodriguez, ME; Blanco, O; Capo, V; Gonzalez, RL; Viera, J; Hengge, UR
AIDS, 21(): 2113-2115.

Back to Top | Article Outline

© 2007 Lippincott Williams & Wilkins, Inc.

Login