Home Current Issue Previous Issues Published Ahead-of-Print Collections For Authors Journal Info
Skip Navigation LinksHome > November 14, 2006 - Volume 20 - Issue 17 > Replicating Ad-recombinants encoding non-myristoylated rathe...
AIDS:
doi: 10.1097/QAD.0b013e32801086ee
Basic Science

Replicating Ad-recombinants encoding non-myristoylated rather than wild-type HIV Nef elicit enhanced cellular immunity

Peng, Boa; Voltan, Rebeccaa; Cristillo, Anthony Db; Alvord, W Gregoryc; Davis-Warren, Albertaa; Zhou, Qifenga; Murthy, Krishna Kd; Robert-Guroff, Marjoriea

Free Access
Article Outline
Collapse Box

Author Information

From the aVaccine Branch, Center for Cancer Research, National Cancer Institute, Bethesda, Maryland, USA

bAdvanced BioScience Laboratories, Inc., Kensington, Maryland, USA

cData Management Services, National Cancer Institute-Frederick, Frederick, Maryland, USA

dSouthwest Foundation for Biomedical Research, San Antonio, Texas, USA.

Received 26 May, 2006

Revised 3 August, 2006

Accepted 5 September, 2006

Correspondence to M. Robert-Guroff, NIH, National Cancer Institute, 41 Medlars Drive, Building 41, Room D804, Bethesda, MD 20892-5065, USA. Tel: +1 301 496 2114; fax: +1 301 402 0055; e-mail: guroffm@mail.nih.gov

Collapse Box

Abstract

Objective: To determine if immunization with non-myristoylated nef would elicit enhanced cellular immune responses resulting from improved presentation of Nef peptides by MHC-I on the cell surface, and enhanced T-cell help.

Design: The myristoylation site of HIV and SIV Nef is required for several Nef functions that modulate the immune response in an infected host, including downregulation of MHC-I, MHC-II, and CD4, and increased expression of the invariant chain on the cell surface. We constructed replication-competent Ad5- and Ad7-HIV recombinants encoding wild-type nef (nefWT) or a nef mutant (nefNM) lacking 19 amino-terminal amino acids, including the myristoylation site, and sequentially immunized chimpanzees mucosally, first with Ad5-HIVnef recombinants and subsequently with Ad7-HIVnef recombinants.

Methods: Peripheral blood lymphocytes were evaluated over the immunization course for Nef-specific cellular immune responses by interferon (IFN)-γ ELISPOT and T-cell proliferation assays. Nef-specific CD4 and CD8 memory T cells that produced intracellular IFN-γ, interleukin-2, and tumor necrosis factor (TNF)-α were assessed by flow cytometry.

Results: In comparison to immunization with Ad-HIVnefWT, Ad-HIVnefNM elicited statistically significant increases in numbers of IFN-γ-secreting cells after the Ad7-HIVnefNM immunization and increased T-cell proliferative responses following both Ad5- and Ad7-HIVnefNM immunizations. Nef-specific CD4 and CD8 memory T-cell populations secreting TNF-α were also significantly increased in the Ad-HIVnefNM immunization group.

Conclusions: The results support the hypothesis that immunization with Ad-recombinants encoding HIVnefNM rather than HIVnefWT elicits enhanced cellular immunity resulting from improved antigen presentation and greater T-cell help.

Back to Top | Article Outline

Introduction

Until strategies to elicit neutralizing antibodies conferring sterilizing immunity are developed, HIV/AIDS vaccines will rely on induction of immune responses able to control viral loads, thus inhibiting viral transmission and disease progression. In this regard, HIV Nef, required for high-titer HIV replication and AIDS development, is an attractive target. Inhibition of its multiple functions, including induction of cell signaling, inhibition of apoptosis, and enhancement of HIV infection [1], could lead to better viremia control. Nef is an early protein expressed from the pre-integrated viral genome [2], rendering it suitable for early targeting by cellular immune responses. Nef is expressed on the surface of infected cells [3], and has been implicated as a target of antibody-dependent cellular cytotoxicity (ADCC) [4]. Thus, vaccine-elicited anti-Nef antibodies might also lead to rapid killing of HIV-infected cells.

Key to the ability of Nef to enhance HIV spread in vivo are its effects on host immune responses. Nef mediates downregulation of CD4 [5] and MHC class I [6] molecules from the surface of infected cells. The former function may impact viral replication and persistence by preventing superinfection and facilitating envelope incorporation into budding particles, resulting in release of new virions [7]. The latter function is an evasive mechanism whereby infected cells become less susceptible to lysis by viral-specific cytotoxic T lymphocytes [8]. The ability of SIV Nef to decrease virus-specific CD8 T-cell responses by downregulating MHC-I has been demonstrated in the SIV-rhesus macaque system [9]. Further, both HIV and SIV Nef downmodulate MHC class II and simultaneously upregulate invariant chain cell-surface expression [10]. The latter prevents antigen presentation by MHC-II [11]. All these phenomena potentially affect the immunogenicity of Nef vaccines by diminishing cell-surface Nef-peptide-MHC-I complexes as targets for cytotoxic T lymphocyte induction, and CD4 help, necessary for elicitation of B- and T-cell responses and induction of cellular memory.

The Nef N-terminal myristoylation site is required for its association with the cell membrane [12], and for mediating downmodulation of cell surface MHC-II and increased invariant chain expression [13]. We reported that deletion of the myristoylation site prevented downmodulation of cell-surface CD4 and MHC-I molecules in vitro, since Nef was no longer anchored at the cell membrane [14]. While other regions of Nef modulate CD4 and MHC-I cell-surface expression, the simple N-terminal deletion preserved almost all known Nef B- and T-cell epitopes, maintaining the suitability of the mutated Nef as a vaccine candidate.

Here we investigated the immunogenicity of non-myristoylated Nef as a potential vaccine candidate. Our vaccine strategy is based on replication-competent Ad-HIV recombinants that elicit enhanced cellular immunity and prime more potent humoral immune responses compared to replication-defective Ad-HIV recombinants [15]. In addition to eliciting potent, persistent immunity, priming with multigenic, replication-competent Ad recombinants followed by boosting with envelope protein subunits elicited strong, durable protection in the SIV-rhesus macaque model [16,17], demonstrating the potential of this vaccine approach. Here we mucosally immunized chimpanzees with replication-competent Ad5- and Ad7-recombinants encoding a wild-type (nefWT) or non-myristoylated (nefNM) Nef. Because human Ads are severely host range restricted, to evaluate a vaccine for humans we selected chimpanzees that allow vector replication and also possess cellular components homologous to those in human cells. In addition to endocytosis at the cell surface, Nef-mediated sorting of newly synthesized CD4 from the trans-Golgi network to endosomes via clathrin adapter complexes may prevent CD4 transport to the cell surface leading to its intracellular retention [18,19]. Further, Nef functions, including modulation of cell signaling and inhibition of apoptosis involve interaction with host factors [1]. It was important to determine if prevention of Nef anchoring at the cell membrane and its resultant accumulation in the cell cytoplasm would diminish induction of potent cellular immunity. We tested the hypothesis that Ad-HIV recombinants encoding non-myristoylated Nef would elicit enhanced cellular immunity compared to wild-type Nef.

Back to Top | Article Outline

Materials and methods

Adenovirus recombinants

pT7consnefhis6, containing a consensus HIV-1 nef gene [20], was from the AIDS Research and Reference Reagent Program, NIAID, NIH. Plasmids pBRAd5ΔE3, pBRAd7ΔE3 and pAd7tpl7-18RD were obtained from Wyeth-Lederle Vaccines under a Cooperative Research and Development Agreement. pAdenoVator-CMV5 (pAV-CMV5) was purchased from QBiogene (Irvine, California, USA). pBRAd5ΔE3 contains the right arm of the Ad5 genome from 59.5 to 100 map units (mu) with an E3 region deletion from 78.8 to 85.7 mu. pBRAd7ΔE3 contains the right arm of the Ad7 genome from 68 to 100 mu with a E3 deletion from 80 to 88 mu.

Replication-competent Ad5-HIVnefWT and HIVnefNM were constructed as follows. HIVnefWT was amplified using PCR primers Nef (WK) p1 (5′–GCGGCCGCGTTAACACCATGGGTGGCAAGTGGTCAAAACGT–3′) and Ad Nef primer A (5′–TTATCAGCAGTCTTTGTAGTACTCCG–3′). HIVnefNM was amplified using Nef (184) primer 6 (5′–GCGGCCGCGTTAACACCATGAGGCGAGCTGAGCCAGCAGCAGA–3′) and the Ad Nef primer A. Both amplified nef gene fragments were inserted separately into pAV-CMV5 between sites Pmel and BamHI, resulting in pCMV5nef-1 (containing HIVnefWT) or pCMV5nef-2 (containing HIVnefNM). Next, the expression cassette of CMV-Ad5tpl-nefWT (or nefNM)-polyA of pCMV5nef-1 or pCMV5nef-2 was amplified using the primer pair of CMV5 p1 (5′–CCTCTAGTTATAGTAATCAATTACGGGGTCATT–3′) and CMV5 p2 (5′–CCTCTAGATCTCCGAGGGATCTCGACCAAAT–3′), and then inserted into the Xba1 site at 78.8 mu of pBRAd5ΔE3, resulting in pBRAd5ΔE3HIVnefWT or pBRAd5ΔE3HIVnefNM. Ad5-HIVnefWT and Ad5-HIVnefNM recombinants were generated by homologous recombination between Ad5 viral DNA (1–75 mu) and pBRAd5ΔE3HIVnefWT or pBRAd5ΔE3HIVnefNM as described previously [21].

Ad7-recombinants carrying HIVnefWT and HIVnefNM were constructed as follows. Using pCMV5nef-1 or pCMV5nef-2 as a template, the CMV promoter, HIVnefWT or HIVnefNM and polyA were amplified separately using PCR with three pairs of primers: CMV5p1 and CMVA7tpl7p2 (5′–GCGATCCGGAAGACGACAGTGGATCTGACGGTTCACTA–3′) and Ad7tplNef1p1 (5′–CAGTCGCAATCGCAAGGTTTAAACACCATGGGTGGCAAGTGGT–3′) or Ad7tplnef2p1 (for HIVnefNM): 5′–CAGTCGCAATCGCAAGGTTTAAACACCATGAGGCGAGCTGAG–3′) and CMV5p2. Next, using pAd7tpl7-18RD as template, the tpl of the Ad7 serotype was amplified using a pair of primers CMVA7tplp1 (5′–TAGTGAACCGTCAGATCCACTGTCTTCCGGATCGC–3′) and Ad7tplNef–1p2 (5′-ACCACTTGCCACCCATGGTGTTTAAACCTTGCGATTGCGACTG–3′) or Ad7tplNef-2p2 (for HIVnefNM): 5′–CTCAGCTCGCCTCATGGTGTTTAAACCTTGCGATTGCGACTG–3′). Finally, an expression cassette of CMV-Ad7tpl-nefWT (or nefNM)-polyA was assembled by combining the above PCR products as template and amplified using the primer pair CMV5p1 and CMV5p2. The amplified expression cassette was inserted into the Xba1 site at 80 mu of pBRAd7ΔE3. The correct orientation and sequence of both pBRAd7ΔE3HIVnefWT and pBRAd7ΔE3HIVnefNM were confirmed by DNA sequencing. Ad7-HIVnefWT and Ad7-HIVnefNM recombinants were generated by homologous recombination between Ad7 viral DNA (1–87 mu) and pBRAd7ΔE3HIVnefWT or pBRAd7ΔE3HIVnefNM as described above.

Nef expression was evaluated by infecting human 293 cells with Ad5-or Ad7-HIVnefWT or Ad5-or Ad7-HIVnefNM (multiplicity of infection, 10). Uninfected 293 cells served as negative controls. When 90% of the cells exhibited a cytopathic effect, lysates were prepared in 50 mM Tris–HCl, pH 8.0, containing 150 mM NaCl, 1% polyethoxyethanol (Sigma, St. Louis, Missouri, USA), 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate (SDS), and 1 mM phenylmethylsulfonyl fluoride, separated on an SDS–polyacrylamide gradient gel of 4–20% (Bio-Rad Laboratories, Inc., Hercules, California, USA) and transferred onto a nitrocellulose membrane (Bio-Rad). Anti-HIV-1 Nef antiserum (AIDS Research and Reference Reagent Program) and the ECL Western blotting detection reagent (Amersham Pharmacia Biotech, Piscataway, New Jersey, USA) were used to visualize bands.

Back to Top | Article Outline
Animals and immunization

Three male and one female chimpanzee, aged 8 to 22 years and possessing comparable Ad5 and Ad7 neutralizing antibody titers (Table 1), were housed at the Southwest Foundation for Biomedical Research (SFBR). The SFBR Animal Care and Use Committee approved the chimpanzee protocols prior to study initiation. Intranasal immunizations of 1 × 107 pfu of Ad5-HIVnefWT or Ad5-HIVnefNM were administered at week 0. A similar dose of Ad7-HIVnefWT or Ad7-HIVnefNM was administered intranasally at week 12. Peripheral blood mononuclear cells (PBMC) were collected periodically and used fresh or viably frozen for evaluating cellular immunity.

Table 1
Table 1
Image Tools
Back to Top | Article Outline
Cellular immune responses

HIV Nef-specific interferon-gamma (IFN-γ)-secreting cells were evaluated using human IFN-γ ELISPOT kits (BD Biosciences, San Diego, California, USA). Consensus HIV Nef peptides were forty-eight 15-mers with an overlap of 11 amino acids (Advanced BioScience Laboratories, Inc. (ABL), Kensington, Maryland, USA). The peptides were pooled and used at a final concentration of 2 μg/ml of each peptide to stimulate serially-diluted PBMC (4 × 105 to 0.5 × 105 cells) for 30 h in 100 μl/well of R10 (RPMI 1640 medium containing 10% human AB serum and 2 mM L-glutamine). Concanavalin A (5 μg/ml; Sigma), R10, and R10 containing 0.3% dimethyl sulfoxide were positive and negative controls, respectively. Spots, counted with a KS ELISPOT reader (Zeiss, Inc., Thornwood, New York, USA), are reported after subtraction of control spots.

T-cell proliferative responses were assessed by culturing105 PBMC/well in triplicate with 1 μg HIV Nef (ABL) for 6 days in 200 μl of R10. The cells were pulsed overnight with [3H]-thymidine (1 μCi/well), harvested and counted. Concanavalin A (5 μg/ml) and R10 were positive and negative controls, respectively. Results are reported as stimulation indices [SI, mean counts per minute (cpm) with Nef/mean cpm with R10].

Back to Top | Article Outline
Intracellular cytokine staining of memory cells

HIV Nef-specific CD8 and CD4 central memory (CD45RA−/CCR7+), effector memory (CD45RA−/CCR7−) and late effector memory (CD45RA+/CCR7−) cells were quantified by flow-cytometry. Viably frozen PBMC were thawed and cultured overnight at 37°C in RPMI/IL-2 [RPMI supplemented with 10% heat-inactivated fetal bovine serum, 100 units/ml penicillin, 100 μg/ml streptomycin, 2 mM L-glutamine, and 20 units/ml recombinant interleukin (IL-2)]. The cells were resuspended in RPMI/IL-2 (2 × 106 cells/ml) and 2 ml were aliquoted into each of three flasks. Cells were unstimulated or stimulated with SEB (200 ng/ml) or Nef peptides (2 μg/ml each) at 37°C, 5% CO2. All cells were co-stimulated with CD28 (1 μg/ml) and CD49d (1 μg/ml). Nef peptide stimulation was for 18 h; Golgi Plug (1 μg/ml) was added for the last 5 h. SEB stimulation was for 5 h in the presence of Golgi Plug. Following stimulation, cells were collected and washed with 1 × phosphate buffered saline (PBS).

Cells were surface stained using mouse anti-human fluoresceine isothiocyanate conjugated anti-CD45RA and phycoerythrin-Cy7-conjugated anti-CD8 (BD BioSciences), and also stained for CCR7 using purified anti-CCR7 (IgM isotype) and anti-IgM-phycoerythrin antibodies (BD BioSciences, Franklin Lakes, New Jersey, USA). Intracellular cytokine staining was then carried out per the manufacturer's protocol using mouse anti-human allophycocyanin-conjugated tumor necrosis factor (TNF)-α, IFN-γ, or IL-2 monoclonal antibodies. Gating was performed as shown in Fig. 1. Cells were acquired (minimum of 10 000 CD8 memory and 20 000 CD4 memory cells) using a FACScalibur cytometer and analysis was performed using Cell Quest software (BD BioSciences). Positive responses were defined as the mean value of pre-bleed samples plus two standard deviations.

Fig. 1
Fig. 1
Image Tools
Back to Top | Article Outline
Statistical analysis

Data were analyzed using repeated measures analysis of variance (ANOVA), linear hierarchical mixed-effects models, generalized least-squares regression models, simple and advanced graphical techniques, and post hoc tests [22–24]. Mixed-effects and generalized least-squares models permit increased flexibility in modeling within-animal correlations in responses over time, thus affording more power than traditional repeated measures designs. In this study, ELISPOT and T-cell proliferative longitudinal responses were most successfully fit with generalized least-squares models. Alternative within-chimp correlation structures (e.g., autoregressive order 1 autocorrelation) were considered in each fit. Assumptions regarding homogeneity of variance and covariance were thoroughly examined with every fit and were required to be fully satisfied in the selection of the best fitting models. Thus, some significant differences between nefWT and nefNM chimps were obtained even with only two animals per group. Aggregates of CD4 and CD8 effector, late effector, and central memory TNF-α peak positive responses in each immunization period were assessed with Student's t test. All tests were two-sided; probability values less than 0.05 were considered significant.

Back to Top | Article Outline

Results

ELISPOT responses

Four chimpanzees were immunized as outlined in Table 1 with Ad5- and Ad7-recombinants encoding HIVnefWT and HIVnefNM, shown to express comparable amounts of NefWT or NefNM protein (Fig. 2a). Over the immunization course, secretion of IFN-γ by PBMC in response to Nef peptides was evaluated by ELISPOT. Nef-specific cellular immune responses were elicited after both the Ad5-HIVnefWT and -HIVnefNM immunizations at week 0 in all four chimpanzees, although numbers of IFN-γ-secreting spot forming cells (SFC) fell to baseline by week 6 post-immunization (Fig. 2b). The mean peak numbers of IFN-γ-secreting SFC ± the standard error of the mean (SEM) per 1 × 106 PBMC for chimpanzees immunized with Ad5-HIVnefWT and Ad5-HIVnefNM were 333 ± 73 and 368 ± 53, respectively. Following administration of Ad7-HIVnef recombinants, responses of chimpanzees immunized with Ad7-HIVnefNM (#202, #424) were boosted, and exhibited an elevated mean peak number of IFN-γ-secreting cells (598 ± 103 SFC/1 × 106 PBMC). The responses of chimpanzees that received Ad7-HIVnefWT (#329, #380) were not boosted (mean peak SFC/1 × 106 PBMC of 193 ± 33). ELISPOT responses over weeks 13–24 showed significantly enhanced cellular immunity in chimpanzees immunized with the Ad-HIVnefNM recombinants (P = 0.0017). Responses in chimpanzees #202 and #424 were also more prolonged after the second immunization, indicative of the boosting effect. Of the two chimpanzees immunized with Ad-HIVnefWT, only #329 exhibited sustained numbers of IFN-γ-secreting cells out to 24 weeks.

Fig. 2
Fig. 2
Image Tools
Back to Top | Article Outline
T-cell proliferative responses

Better Nef-specific T-cell proliferative responses were also induced by Ad-HIVnefNM immunization compared to Ad-HIVnefWT (Fig. 2c). Following initial immunization, the mean SI ± SEM for chimpanzees that received Ad5-HIVnefWT was 3.1 ± 0.5, but was 8.0 ± 1.6 for those immunized with Ad5-HIVnefNM. Similarly to ELISPOT responses, following the booster immunizations, proliferative responses of chimpanzees immunized with Ad7-HIVnefWT were not boosted (mean peak SI of 1.9 ± 0.3) while chimpanzees immunized with Ad7-HIVnefNM exhibited slightly elevated responses (mean peak SI of 10.4 ± 1.3). The greater proliferative responses in chimpanzees #202 and #424, compared to #329 and #380, after both the first Ad5-HIVnefNM immunization (week 1) and second Ad7-HIVnefNM immunization (weeks 13 and 14) were significant, P = 0.0012.

Back to Top | Article Outline
T-cell memory responses

We evaluated whether the Nef myristoylation site deletion influenced induction of Nef-specific CD4 and CD8 central (TCM), effector (TEM) and/or late effector memory (LEM, TEMRA or terminally differentiated) memory T cells. Memory T cells are heterogeneous and exhibit a spectrum of distinct phenotypes and functional capacities [25]. However, expression of CCR7, a chemokine receptor that controls homing to secondary lymphoid organs, divides CD45RA− cells into distinct TCM and TEM populations [26]. Additionally, CCR7 expression on CD45RA+ cells distinguishes naïve (CCR7+) from LEM CD4 and CD8 T cells [27,28]. Following stimulation with Nef peptides, CD45RA− CD4 and CD8 T cells, positive (TCM) or negative (TEM) for CCR7 expression, and CD45RA+CCR7− LEM CD4 and CD8 T cells were analyzed for expression of IFN-γ, IL-2, and TNF-α. Meaningful quantification of cellular immune responses requires measurement of more than a single cytokine. Secretion of IFN-γ is often a subdominant response [29]. Thus, percentages of CD4 memory T cells expressing each of the three cytokines were measured (Fig. 3). TNF-α was the most prevalent cytokine produced in response to Nef stimulation, although cells secreting IFN-γ and IL-2 were also observed. Chimpanzees immunized with Ad-HIVnefNM (#202, #424) exhibited sustained CD4 TCM populations following the second Ad-recombinant immunization whereas chimpanzees immunized with Ad-HIVnefWT (#329, #380) did not. With only two chimpanzees per group, insufficient data were available for statistical analysis of each of the individual CD4 T-cell memory populations. Therefore, we analyzed total CD4 memory cells (EM, LEM, and CM) after both immunizations, limiting our analysis to TNF-α-secreting cells, since some cells might have secreted more than one cytokine. A significant enhancement of the TNF-α response was observed in chimpanzees immunized with Ad-HIVnefNM compared to those immunized with Ad-HIVnefWT (P = 0.049).

Fig. 3
Fig. 3
Image Tools

Nef-specific CD8 memory T cells also exhibited a predominant TNF-α response (Fig. 4). Statistical analysis similar to that conducted for the CD4 cells showed significant enhancement of the total CD8 memory T cells in chimpanzees administered Ad-HIVnefNM compared to those administered Ad-HIVnefWT (P = 0.013).

Fig. 4
Fig. 4
Image Tools
Back to Top | Article Outline

Discussion

Here we show that Ad-HIVnefNM recombinants elicit enhanced cellular immunity compared to Ad-HIVnefWT. The lack of boosting of cellular immune responses following the second Ad-HIVnefWT immunization may reflect a loss of CD4 help resulting from Nef-mediated downmodulation of MHC-II and/or CD4 together with increased cell-surface expression of the invariant chain. These effects that require the Nef myristoylation site would have been diminished or abrogated in chimpanzees immunized with Ad-HIVnefNM, allowing boosting to occur. While memory CD8 T cells can be generated in the absence of CD4 help, their quality is CD4 dependent [30]. Such cells exhibit poor recall responses and little proliferative capacity upon encountering antigen a second time [31–34]. Here, lack of CD4 help resulting from downmodulation of MHC-II and/or CD4 would have allowed a primary immune response, but an impaired recall response. This was seen in the ELISPOT results, where similar levels of IFN-γ-secreting cells were exhibited by animals in both immunization groups after the first immunization. However, following the second, elevated responses were seen only in chimpanzees immunized with Ad-HIVnefNM.

With regard to proliferation, Ad-HIVnefNM elicited strong proliferative responses following each immunization. In contrast, only low-level SI were observed in the Ad-HIVnefWT group, after both the first and second immunizations. In this case, downregulation of MHC-II and CD4 likely affected both the primary and recall responses.

A successful vaccine for HIV/AIDS will need to elicit memory T cells. While the lineage derivation of TCM and TEM is controversial [25,35], it is clear that TCM home to lymph nodes and can proliferate extensively, while TEM traffic to peripheral tissues and exhibit a more limited proliferative capacity. TEM secrete cytokines and provide immediate protection, while TCM contribute to long-term protection and recall responses [36]. Terminally differentiated LEM represent a smaller population of memory T cells and are less relevant to vaccine development. They exhibit potent effector function, but poor proliferative capacity [27,28]. Nevertheless, for completeness we examined the three memory populations of both CD4 and CD8 cells, measuring secretion of IFN-γ, IL-2, and TNF-α to estimate the quality of the cellular immune response [37]. Overall, immunization with Ad-HIVnefNM recombinants elicited significantly higher TNF-α responses across the three memory subpopulations of both CD4 and CD8 cells. The response patterns are consistent with the observed ELISPOT and T-cell proliferative recall responses in the chimpanzees.

We previously reported that in vitro transfection of cells with HIVnefNM abrogates downmodulation of both MHC-1 and CD4 [14]. However, elucidation of the mechanisms leading to the enhanced cellular immunity observed here requires further study. Both the loss of Nef function and altered processing of the mutated Nef protein may have played a role. Further, the Nef immunogens were administered as Ad-recombinants that could have influenced the experimental outcome. Expression of NefWT protein might have decreased immunity to the vaccine vector, leading to prolonged replication and expression of Nef, providing a greater opportunity for induction of Nef-specific immunity. Similarly, maintenance of MHC-1 and CD4 on cells infected with Ad-HIVnefNM might have resulted in faster clearance of the Ad-recombinant and diminished cellular immunity to Nef. Thus, if Nef expression influenced persistence of the replication-competent Ad-recombinants, greater immunity upon immunization with Ad-HIVnefWT recombinants would have been expected. The extent to which host immunity to the vaccine vector may have influenced induction of cellular immunity to Nef should be further explored by evaluating Ad-specific immune responses.

Cell-surface expression of Nef on infected cells might provide a target for anti-Nef antibodies mediating ADCC. Here, we focused on cellular immunity, as vectored vaccines are primarily intended to elicit cellular rather than humoral responses. In fact, only low-level anti-Nef antibodies were elicited. Peak titers for each chimpanzee were 75 (#329), 285 (#380), 230 (#202), and < 50 (#424). Development of high-titered anti-Nef antibodies will require boosting with Nef protein. Future studies should examine if higher anti-Nef titers are induced with Ad-HIVnefNM prime/protein boost regimens, where CD4 help should be better maintained.

The multifunctional Nef protein has additional immunomodulatory properties including downmodulation of the TCR/CD3 complex [38]. While the majority of SIV Nefs (and HIV-2 Nef) possess this activity, facilitating viral persistence and non-pathogenicity in natural hosts, HIV-1 Nef alleles appear to have lost this property [39] and hence the ability to suppress T-cell activation. The ability to downmodulate the T-cell receptor (TCR) has been mapped to a central core region of Nef (amino acids 109–134) and to the myristoylation site [40]. Thus, while HIV Nef vaccines would be unaffected, TCR/CD3 downmodulation should be abrogated by SIV NefNM constructs, leading to enhanced cellular immunity. This speculation remains to be tested.

HIV nef is an excellent vaccine candidate based on its potent induction of cellular immunity for a protein of its size, its relatively conserved sequence, and its overall immunogenicity [41]. It is well recognized by the immune system, as seen by potent immune responses early in infection [42] and broad recognition in people of multiple ethnicities [43]. Nef-specific cellular immune responses in highly exposed persistently HIV-seronegative individuals [44] suggest that Nef may contribute to protection. Pre-clinical studies in non-human primates have shown that nef-based vaccines are immunogenic [45,46] and contribute to protective efficacy in macaques against SIV and SHIV challenges [16,47,48]. As immune therapeutic agents, HIV nef vaccines have also been shown to elicit new cellular immune responses in HIV infected individuals [49,50]. The enhanced cellular immune responses exhibited here in response to immunization with Ad-recombinants encoding non-myristoylated nef indicate a significant advantage over immunizations with Ad-HIVnefWT recombinants. We conclude that non-myristoylated Nef vaccine candidates merit testing in future human clinical trials and predict that they will prove to be important vaccine components based on the promising potential of Nef vaccines shown to date.

Back to Top | Article Outline

Acknowledgements

We thank Leilei He for excellent technical support. The following reagents were obtained through the AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH: pT7consnefhis6 and HIV-1 Nef antiserum, both from Dr. Ronald Swanstrom.

Sponsorship: This study was supported in part by the Intramural Research Program of the NIH, National Cancer Institute. Animal resources in support of this study were provided under N01-AI-85350 from the Division of AIDS, NIAID.

Back to Top | Article Outline

References

1. Joseph AM, Kumar M, Mitra D. Nef: ‘Necessary and enforcing factor’ in HIV infection. Curr HIV Res 2005; 3:87–94.

2. Wu Y, Marsh JW. Selective transcription and modulation of resting T cell activity by preintegrated HIV DNA. Science 2001; 293:1503–1506.

3. Fujii Y, Nishino Y, Nakaya T, Tokynaga K, Ikuta K. Expression of human immunodeficiency virus type 1 Nef antigen on the surface of acutely and persistently infected human T cells. Vaccine 1993; 11:1240–1246.

4. Yamada T, Watanabe N, Nakamura T, Iwamoto A. Antibody-dependent cellular cytotoxicity via humoral immune epitope of Nef protein expressed on cell surface. J Immunol 2004; 172:2401–2406.

5. Garcia JV, Miller AD. Serine phosphorylation-independent downregulation of cell-surface CD4 by nef. Nature 1991; 350:508–511.

6. Schwartz O, Marechal V, LeGall S, Lemonnier F, Heard JM. Endocytosis of major histocompatibility complex class I molecules is induced by the HIV-1 Nef protein. Nat Med 1996; 2:338–342.

7. Tolstrup M, Ostergaard L, Laursen AL, Pedersen SF, Duch M. HIV/SIV escape from immune surveillance: focus on Nef. Curr HIV Res 2004; 2:141–151.

8. Collins KL, Chen BK, Kalams SA, Walker BD, Baltimore D. HIV-1 Nef protein protects infected primary cells against killing by cytotoxic T lymphocytes. Nature 1998; 391:397–401.

9. Swigut T, Alexander L, Morgan J, Lifson J, Mansfield KG, Lang S, et al. Impact of Nef-mediated downregulation of major histocompatibility complex class I on immune response to simian immunodeficiency virus. J Virol 2004; 78:13335–13344.

10. Schindler M, Wurfl S, Benaroch P, Greenough TC, Daniels R, Easterbrook P, et al. Down-modulation of mature major histocompatibility complex class II and up-regulation of invariant chain cell surface expression are well-conserved functions of human and simian immunodeficiency virus nef alleles. J Virol 2003; 77:10548–10556.

11. Roche PA, Teletski CL, Karp DR, Pinet V, Bakke O, Long EL. Stable surface expression of invariant chain prevents peptide presentation by HLA-DR. EMBO J 1992; 11:2841–2847.

12. Geyer M, Fackler OT, Peterlin BM. Structure–function relationships in HIV-1 Nef. EMBO Rep 2001; 2:580–585.

13. Stumptner-Cuvelette P, Morchoisne S, Dugast M, Le Gall S, Raposo G, Schwartz O, et al. HIV-1 Nef impairs MHC class II antigen presentation and surface expression. Proc Natl Acad Sci USA 2001; 98:12144–12149.

14. Peng B, Robert-Guroff M. Deletion of N-terminal myristoylation site of HIV Nef abrogates both MHC-1 and CD4 down-regulation. Immunol Lett 2001; 78:195–200.

15. Peng B, Wang LR, Gomez-Roman VR, Davis-Warren A, Montefiori DC, Kalyanaraman VS, et al. Replicating rather than non-replicating Adenovirus-human immunodeficiency virus recombinant vaccines are better at eliciting potent cellular immunity and priming high titer antibodies. J Virol 2005; 79:10200–10209.

16. Patterson LJ, Malkevitch N, Venzon D, Pinczewski J, Gomez-Roman VR, Wang L, et al. Protection against mucosal SIVmac251 challenge using replicating adenovirus-SIV multi-gene vaccine priming and subunit boosting. J Virol 2004; 78:2212–2221.

17. Malkevitch NV, Patterson LJ, Aldrich MK, Wu Y, Venzon D, Florese RH, et al. Durable protection of rhesus macaques immunized with a replicating Adenovirus-SIV multige ne prime/protein boost vaccine regimen against a second SIVmac251 rectal challenge: role of SIV-specific CD8+ T cell responses. Virology, in press.

18. Levesque K, Finzi A, Binette J, Cohen EA. Role of CD4 receptor down-regulation during HIV-1 infection. Curr HIV Res 2004; 2:51–59.

19. Rose JJ, Janvier K, Chandrasekhar S, Sekaly RP, Bonifacino JS, Venkatesan S. CD4 down-regulation by HIV-1 and simian immunodeficiency virus (SIV) Nef proteins involves both internalization and intracellular retention mechanisms. J Biol Chem 2005; 280:7413–7426.

20. Shugars DC, Smith MS, Glueck DH, Nantermet PV, Seillier-Moiseiwitsch R, Swanstrom R. Analysis of human immunodeficiency virus type 1 nef gene sequences present in vivo. J Virol 1993; 67:4639–4650.

21. Zhao J, Lou Y, Pinczewski J, Malkevitch N, Aldrich K, Kalyanaraman VS, et al. Boosting of SIV-specific immune responses in rhesus macaques by repeated administration of Ad5hr-SIVenv/rev and Ad5hr-SIVgag recombinants. Vaccine 2003; 21:4022–4035.

22. Littell RC, Milliken GA, Stroup WW, Wolfinger RD. SAS System for Mixed Models. Cary, North Carolina: SAS Institute Inc; 1996.

23. Milliken GA, Johnson DE. Analysis of Messy Data, Volume 1: Designed Experiments. New York: Chapman and Hall; 1992.

24. Pinheiro JC, Bates DM. Mixed-Effects Models in S and S-Plus. New York: Springer-Verlag; 2000.

25. Sallusto F, Geginat J, Lanzavecchia A. Central memory and effector memory T cell subsets: function, generation, and maintenance. Annu Rev Immunol 2004; 22:745–763.

26. Sallusto F, Lenig D, Forster R, Lipp M, Lanzavecchia A. Two subsets of memory T lymphocytes with distinct homing potentials and effector functions. Nature 1999; 401:708–712.

27. Harari A, Vallelian F, Pantaleo G. Phenotypic heterogeneity of antigen-specific CD4 T cells under different conditions of antigen persistence and antigen load. Eur J Immunol 2004; 34:3525–3533.

28. Geginat J, Lanzavecchia A, Sallusto F. Proliferation and differentiation potential of human CD8+ memory T-cell subsets in response to antigen or homeostatic cytokines. Blood 2003; 101:4260–4266.

29. De Rosa SC, Lu FX, Yu J, Perfetto SP, Falloon J, Moser S, et al. Vaccination in humans generates broad T cell cytokine responses. J Immunol 2004; 173:5372–5380.

30. Kaech SM, Ahmed R. CD8 T cells remember with a little help. Science 2003; 300:263–265.

31. Bourgeois C, Rocha B, Tanchot C. A role for CD40 expression on CD8+ T cells in the generation of CD8+ T cell memory. Science 2002; 297:2060–2063.

32. Janssen EM, Lemmens EE, Wolfe T, Christen U, von Herrath MG, Schoenberger SP. CD4+ T cells are required for secondary expansion and memory in CD8+ T lymphocytes. Nature 2003; 421:852–856.

33. Shedlock DJ, Shen H. Requirement for CD4 T cell help in generating functional CD8 T cell memory. Science 2003; 300:337–339.

34. Sun JC, Bevan MJ. Defective CD8 T cell memory following acute infection without CD4 T cell help. Science 2003; 300:339–342.

35. Wherry EJ, Teichgraber V, Becker TC, Masopust D, Kaech SM, Antia R, et al. Lineage relationship and protective immunity of memory CD8 T cell subsets. Nat Immunol 2003; 4:225–234.

36. Lanzavecchia A, Sallusto F. Understanding the generation and function of memory T cell subsets. Curr Opin Immunol 2005; 17:326–332.

37. Wille-Reece U, Flynn BJ, Lore K, Koup RA, Kedl RM, Mattapallil JJ, et al. HIV Gag protein conjugated to a Toll-like receptor 7/8 agonist improves the magnitude and quality of Th1 and CD8+ T cell responses in nonhuman primates. Proc Natl Acad Sci USA 2005; 102:15190–15194.

38. Bell I, Schaefer TM, Trible RP, Amedee A, Reinhart TA. Down-modulation of the costimulatory molecule, CD28, is a conserved activity of multiple SIV Nefs and is dependent on histidine 196 of Nef. Virology 2001; 283:148–158.

39. Schindler M, Munch J, Kutsch O, Li H, Santiago ML, Bibollet-Ruche F, et al. Nef-mediated suppression of T cell activation was lost in a lentiviral lineage that gave rise to HIV-1. Cell 2006; 125:1005–1067.

40. Schaefer TM, Bell I, Pfeifer ME, Ghosh M, Trible RP, Fuller CL, et al. The conserved process of TCR/CD3 complex down-modulation by SIV Nef is mediated by the central core, not endocytic motifs. Virology 2002; 302:106–122.

41. Betts MR, Yusim K, Koup RA. Optimal antigens for HIV vaccines based on CD8+ T response, protein length, and sequence variability. DNA Cell Biol 2002; 21:665–670.

42. Lichterfeld M, Yu XG, Cohen D, Addo MM, Malenfant J, Perkins B, et al. HIV-1 Nef is preferentially recognized by CD8 T cells in primary HIV-1 infection despite a relatively high degree of genetic diversity. AIDS 2004; 18:1383–1392.

43. Frahm N, Korber BT, Adams CM, Szinger JJ, Draenert R, Addo MM, et al. Consistent cytotoxic-T-lymphocyte targeting of immunodominant regions in human immunodeficiency virus across multiple ethnicities. J Virol 2004; 78:2187–2200.

44. Rowland-Jones S, Sutton J, Ariyoshi K, Dong T, Gotch F, McAdam S, et al. HIV-specific cytotoxic T-cells in HIV-exposed but uninfected Gambian women. Nat Med 1995; 1:59–64. Erratum: Nat Med 1995; 1:598.

45. Patterson LJ, Malkevitch N, Zhao J, Peng B, Robert-Guroff M. Potent, persistent cellular immune responses elicited by sequential immunization of rhesus macaques with Ad5 host range mutant recombinants encoding SIV Rev and SIV Nef. DNA Cell Biol 2002; 21:627–635.

46. Hel Z, Tryniszewska E, Tsai WP, Johnson JM, Harrod R, Fullen J, et al. Design and in vivo immunogenicity of a polyvalent vaccine based on SIVmac regulatory genes. DNA Cell Biol 2002; 21:619–626.

47. Erfle V, Goebel FD, Guzman CA, LeGrand R. Vaccines based on Nef and on Nef/ΔV2 Env. Microbes Infect 2005; 7:1400–1404.

48. Voss G, Manson K, Montefiori D, Watkins DI, Heeney J, Wyand M, et al. Prevention of disease induced by a partially heterologous AIDS virus in rhesus monkeys by using an adjuvanted multicomponent protein vaccine. J Virol 2003; 77:1049–1058.

49. Cosma A, Nagaraj R, Bühler S, Hinkula J, Busch DH, Sutter G, et al. Therapeutic vaccination with MVA-HIV-1 nef elicits Nef-specific T-helper cell responses in chronically HIV-1 infected individuals. Vaccine 2003; 22:21–29.

50. Harrer E, Bauerle M, Ferstl B, Chaplin P, Petzold B, Mateo L, et al. Therapeutic vaccination of HIV-1-infected patients on HAART with a recombinant HIV-1 nef-expressing MVA: safety, immunogenicity and influence on viral load during treatment interruption. Antivir Ther 2005; 10:285–300.

Keywords:

vaccine; cellular immunity; CD4; primate; animal models

© 2006 Lippincott Williams & Wilkins, Inc.

Login

Search for Similar Articles
You may search for similar articles that contain these same keywords or you may modify the keyword list to augment your search.