Skip Navigation LinksHome > March 21, 2006 - Volume 20 - Issue 5 > A nonsense mutation (428G→A) in the fucosyltransferase FUT2...
AIDS:
doi: 10.1097/01.aids.0000216368.23325.bc
Basic Science: Concise Communication

A nonsense mutation (428G→A) in the fucosyltransferase FUT2 gene affects the progression of HIV-1 infection

Kindberg, Elina,b; Hejdeman, Boc; Bratt, Göranc; Wahren, Brittad; Lindblom, Bertila; Hinkula, Jormab,d; Svensson, Lennartb

Free Access
Article Outline
Collapse Box

Author Information

From the aDepartment of Forensic Genetics, National Board of Forensic Medicine, University Hospital, Linköping, Sweden

bDivision of Molecular Virology, University of Linköping, Sweden

cVenhälsan, Department of Infectious Diseases, Karolinska University Hospital, Stockholm, Sweden

dDepartment of Virology, Swedish institute for Infectious Disease Control and MTC Karolinska Institutet, Stockholm, Sweden.

Received 6 October, 2005

Revised 30 December, 2005

Accepted 12 January, 2006

Correspondence to L. Svensson, Division of Molecular Virology, Medical Faculty (IMK), University of Linköping, 581 85 Linköping, Sweden. Tel: +46 13 228803; fax: +46 13 221375; e-mail: lensv@imk.liu.se

Collapse Box

Abstract

Background: The human FUT2 gene encodes the α(1,2)fucosyltransferase that determines secretor status. Homozygous for the nonsense mutation are called non-secretors and are unable to express histo-blood group antigens in secretions and on mucosal surfaces. In this study we have investigated the importance of the FUT2 fucosyltransferase activity on the progress of HIV-1 infection.

Methods: Swedish blood donors (n = 276), 15 long-term non-progressors (LTNP) and 19 progressors were genotyped with respect to the nonsense mutation 428G→A in the FUT2 gene. In addition 265/276 blood donors and 19 progressors with rapid or expected progression rate were Δ32 CCR5 genotyped.

Results: Of 276 blood donors 218 (79%) were found to be secretor positive (se+), either homozygous (se+/+) wild type (30%) or heterozygous (se+/−) (49%) and 58 (21%) were homozygous non-secretors (se−/−). Five LTNP (33%) were found to be secretor-positive (se+/+, se+/−) and 10 (67%) se−/−. Of the 19 individuals with normal HIV-1 progression 15 (79 %) were found to be secretor positive and four (21%) were non-secretors. No frequency differences were found in the Δ32 CCR5 allele among the groups studied.

Conclusion: Strong association (P < 0.001) was observed between the nonsense mutation 428G→A in the FUT2 gene and a slow disease progression of HIV-1 infection.

Back to Top | Article Outline

Introduction

The progression rate of an HIV-1 infection is dependent on both viral [1] and host genetic factors [2,3], including at least five different co-receptors or primary ligands; CCR5Δ32 [4], CCR5 59029G/A [2], CCR2-64I [2], SDF-1 3′A [2] and CCR5 P1 [3]. A relationship has also been suggested between reduced risk of heterosexual transmission of HIV-1 and polymorphism in the α(1,2)fucosyltransferase FUT2 gene, regulating the secretor status. A study by Ali et al., showed association between the non-secretor genotype and a reduced risk to be infected with HIV-1, among Senegalese commercial sex workers [5]. Similarly, Blackwell et al. reported an association between non-secretors and resistance to HIV infection [6]. Furthermore, a recent observation have not only illustrated the importance of histo-blood group antigens on host cells, but also that HIV-1 incorporates the ABH antigen and that infection of lymphocytes by HIV-1 appears to activate expression of glycosyltransferases [7], further supporting a role of fucosyl and glycosyltransferases in the pathogenesis of HIV-1.

The secretor status of an individual relates to the presence of H-antigen, a precursor oligosaccharide molecule of the ABO-antigens that is determined by the Secretor (FUT2) gene, encoding a fucosyltransferase [8]. Secretor-negative individuals are termed non-secretors, and lack H-antigen both on gastro-intestinal epithelium and in body fluids [9].

Several different polymorphisms are known in the FUT2 gene, some are so-called silent mutations, while others give rise to non-functional enzymes. Homozygous individuals with non-functional enzymes are termed non-secretors (se−/−). Heterozygous individuals on the other hand, carrying one functional allele, have secretion similar to the wild-type and are termed secretors (se+) [9].

Single nucleotide polymorphisms (SNP) in the FUT2 gene are related to ethnicity [9], with 20% of the Caucasian population being homozygous non-secretors at position 428 [9]. This mutation causes a switch of amino acid 143 from a tryptophan to a stop codon, which results in a truncated, non-functional protein [10].

The majority of HIV-infected patients experience an asymptomatic period after seroconversion and most develop AIDS within 10 years of HIV infection without antiretroviral treatment [11]. However some infected individuals remain asymptomatic for a long period and these are called long-term non-progressors (LTNP) [12]. Typically for these patients are more than 7 years of documented HIV infection, a stable, normal CD4+ cell count over time, no symptoms of HIV-induced disease, low levels of HIV virus in the peripheral blood and no history of antiretroviral treatment [13].

Earlier studies of Swedish homosexual men have shown that the CCR5Δ32 allele has a protective effect against HIV-1 disease progression for several individuals [14]. This protection may be limited to the first years of infection until phenotype switch, from viruses using CCR5 as co-receptor to viruses using CXCR4 [14]. From these studies we also knew that the CCR5 32-base-pair deletion could not explain the slower than expected disease progression among the LTNP individuals examined in this study [15]. Since FUT2 regulates the expression of a carbohydrate on the gastrointestinal epithelium, we decided to investigate the possible association between secretor status and disease progression among LTNP.

Back to Top | Article Outline

Methods

Patients

All HIV-1 infected study participants were homosexual men from the Venhälsan, Karolinska University Hospital, mean age 40 years, (> 400 × CD4 cells/μl). The definition of the slow progressor group and the rapid progressors were defined as described. Slow progressors (LTNP) were defined as male homosexuals with documented HIV-1 infection over 6 years (median time from HIV-1 diagnosis: 7 years, range, 6–16 years) duration. They were individuals with a positive or stable monthly CD4-cell slope (CD4-cell slope, +2.12 × CD4 cells/μl; range, +0.06–7.86 × CD4 cells/μl) during the study period with no antiviral treatment. Rapid progressors were defined as having reached an AIDS-defining event in less than 5 years (median time from HIV-1 diagnosis, range 2–5 years) or having a monthly CD4 cell slope of ≥ −7 × CD4 cells/μl (mean, + 1SD; range, −7 to −12.9) and having reached a need of anti-retroviral drug treatment in less then 6 years.

Back to Top | Article Outline
DNA extraction

DNA was obtained from 15 LTNP, 19 HIV-1 infected individuals with rapid or expected disease progression rate and 276 Swedish blood donors. DNA was purified from the first two groups using a QIAamp DNA Blood Minikit (Qiagen, Hilden, Germany), and DNA from blood donors by the DTAB/CTAB (dodecyltrimethylammoniumbromide/cetyltrimethylammoniumbromide) method [16]. Purified DNA from blood donors was stored frozen in micro-titre plates (10 ng/μl in TE buffer) until analysed.

Back to Top | Article Outline
PCR and sequencing primers

Primers (Invitrogen AB, Lidingö, Sweden) for the initial PCR amplification and the pyrosequencing reaction were designed using conventional standard criteria. Primer specificity was checked with published nucleotide sequences using BLAST (http://www.ncbi.nlm.nih.gov/BLAST/) and analysed for the risk of primer–dimer formation and secondary structures using Pyrosequencing Assay Design Software version 1.0. The following pair of primers was used for the FUT2 PCR: 5′—BIOTIN–GATGGAGGAGGAATACCGCCAC—3′ (F) and 5′—TGGGCCTCCTCCCGCACGT—3′ (R). For sequencing the 5′—GGTGGTGGTAGAAGGTC—3′ primer was used. For CCR5 genotyping the following pair of amplification primers were used: 5′—CACCTGCAGCTCTCATTTTCC—3′ (F) and 5′—BIOTIN–GTTTTTAGGATTCCCGAGTAGCA—3′ (R). The sequencing primer was 5′—CAGCTCTCATTTTCCAT—3′.

Back to Top | Article Outline
PCR (FUT2 and CCR5)

To 1 μl DNA (≥ 10 μg), 17.3 μl water, 0.5 μl 20 μM forward primer, 0.5 μl 20 μM reverse primer, 2.5 μl PCR buffer, 1 μl dNTPs, 2 μl MgCl2 and 0.2 μl TaqGold (Applied Biosystems, Branchburg, New Jersey, USA) was added. Amplification conditions for the FUT2 and CCR5 sequences were one cycle of 300 s at 95°C followed by 50 cycles of 15 s at 95°C, 30 s at 65 °C and 30 s at 72 °C and finally one cycle of 300 s at 72°C, followed by 4°C. The PCR was performed by Model 9600 from Applied Biosystems.

Back to Top | Article Outline
Separation by electrophoresis

Amplified products were separated by electrophoresis (Electrophoresis Power Supply, EPS 301, Amersham Biosciences, Buckinghamshire, UK) on a 1.5% agarose gel and visualized by ethidium bromide staining after exposure to ultraviolet light. The sizes of the final fragments were 131 bp (FUT2) and 132 bp (CCR5).

Back to Top | Article Outline
Pyrosequencing

Pyrosequencing was performed essentially as described by Ronaghi et al. [17]. Briefly amplified DNA from the PCR reactions was mixed with a pyrosequencing mastermix containing 3 μl sepharose–streptavidin conjugate, 37 μl binding buffer (10 mM Tris–HCl, 2 M NaCl, 1 mM EDTA, 0.1% Tween 20 pH 7.6) and 15 μl water for each 25 μl PCR product. The mixture was then mix-incubated for 20 min, 22°C at 1300 rpm (Thermomixer Comfort, Eppendorf, Hamburg, Germany). Samples were set to a mix of 43.5 μl annealing buffer (Biotage AB, Uppsala, Sweden) containing 20 mM Tris–acetate and 2 mM MgAc2 and 1.5 μl 10 μM primer per sample. Annealing was performed for 2 min at 80°C, followed by addition of substrates, enzymes (50 μl + 5 μl per number of samples) and dNTPs (50 μl + 1 μl per number of samples of each dNTP) from the SNP Reagent Kit (code number 40–0023, Biotage AB). The pyrosequencing reaction was carried out with the dispension order GCTCAGAGC (FUT2) and GACAGTC (CCR5), in a PSQ 96 MA Instrument (Biotage AB).

Back to Top | Article Outline
Statistical calculation

Conformity with Hardy–Weinberg equilibrium [18] of genotypic frequencies was tested using allelic and genotypic proportions. The significance of phenotypic differences between populations was calculated by Fisher exact test with 95% confidence interval.

Back to Top | Article Outline

Results

To investigate the possible association between the nonsense mutation (428 G→A) in the FUT2 gene and HIV disease progression, 276 Swedish blood donors were first genotyped by pyrosequencing to establish the allele frequency in the Swedish population. The genotyping revealed that 82 (29.7%) of the 276 blood donors were homozygous wild types (se+/+), 136 (49.3%) were heterozygous (se+/−) and 58 (21.0%) were found to be non-secretors (se−/−) (Table 1). Of the 15 LTNP examined, two (13.3%) were carriers of two wild-type alleles, three (20.0%) were heterozygous and 10 (66.7%) were non-secretors (Table 1). This was in strong contrast to the FUT2 genotype profile of HIV infected individuals with expected or rapid disease progression rate which was similar to the profile of the blood donors; five individuals (26%) were homozygous wild-types, 10 (53%) were heterozygous and four (21%) were homozygous (Table 1). Furthermore, the allele frequency 428A was significantly higher in LTNP, than in progressors and blood donors (Table 1).

Table 1
Table 1
Image Tools

While the nonsense 428 G→A mutation was significantly over represented among LTNP, the Δ32 CCR5 allele frequency was similar in all three groups investigated (Table 1). Of 265 blood donors, 213 (80.3%) were homozygous wild-types, 51 (19.2%) were heterozygous and one (0.4%) was homozygous for the deletion. The allele frequency of the Δ32 CCR5 in the blood donor material was 0.1 and agreed with the expected frequencies of Hardy–Weinberg equilibrium.

Back to Top | Article Outline

Discussion

The frequency of the Δ32 CCR5 allele, known to affect the disease progression rate of an HIV-1 infection [4], was the same (∼10%) in all three groups studied (Table 1) and agrees with earlier studies [19,20]. This suggests that CCR5 could not explain the difference in disease progression rate between the two groups of HIV-1 infected individuals examined in this study. Instead we found that secretor status was highly associated with slow but not rapid HIV-1 progression, with LTNP patients being significantly more often non-secretors than secretors. Of 276 Swedish blood donors, 21.0% were non-secretors compared with 66.7% among LTNP.

In contrast to LTNP, the FUT2 genotype profile of the HIV infected individuals with expected or rapid disease progression were not different from the blood donors (Table 1). Our findings can be compared with those of Blackwell et al. [6], and those of Ali et al. [5], showing that non-secretors run a lower risk of being infected by HIV-1. A more recent study by Puissant et al. observed however that the Lewisb antigen, present in secretor positive individuals, had a slight protective effect against HIV infection, at least among blood group A individuals [21]. In support of those observations showing that non-secretors are at a lower risk of being infected, we report for the first time that slow rate of disease progression is strongly associated with the nonsense mutation 428G→A in the FUT2 gene.

As many pathogens including HIV use carbohydrate-binding proteins as primary or secondary receptor, we hypothesize that a glycolipid receptor used by HIV is regulated by the fucosyltransferase FUT2. It cannot be ruled out that polymorphism in glycosyl and fucosyl transferases influence the outcome of disease progression by interference both on host cell and viral glycoprotein synthesis. Indeed glycosylation, which is encoded by the host cell is important for proper maturation of gp120 [22]. One possibility is that the lack of fucosylation, normally catalysed by the FUT2 enzyme, prevents the formation of a glycolipid receptor for HIV-1 on the epithelial surface. When this receptor is not properly folded the increase of viral load may not occur as expected. The fact that FUT2 polymorphisms and secretor status have a ethnical and geographical correlation [9] with 20% of Europeans being non-secretors and only a few cases in Asia, raises interesting questions about HIV and host cell adaptation. An example of pathogen–host cell co-evolution is Helicobacter pylori and the Lewisb antigen, with the Lewisb antigen being dependent on the secretor H-antigen. It has been shown that blood group O-dependent H. pylori dominate in populations where O is the dominating human blood group, while strains binding A, B and O generally have a broader distribution [23].

Back to Top | Article Outline

Acknowledgements

This study was supported by the Swedish Research Council (grant 8266), the Swedish Medical Society, and by the Health research Council in the South-East of Sweden.

Back to Top | Article Outline

References

1. Connor RI, Sheridan KE, Ceradini D, Choe S, Landau NR. Change in coreceptor use coreceptor use correlates with disease progression in HIV-1-infected individuals. J Exp Med 1997; 185:621–628.

2. Mummidi S, Ahuja SS, Gonzalez E, Anderson SA, Santiago EN, Stephan KT, et al. Genealogy of the CCR5 locus and chemokine system gene variants associated with altered rates of HIV-1 disease progression. Nat Med 1998; 4:786–793.

3. Martin MP, Dean M, Smith MW, Winkler C, Gerrard B, Michael NL, et al. Genetic acceleration of AIDS progression by a promoter variant of CCR5. Science 1998; 282:1907–1911.

4. Singh KK, Barroga CF, Hughes MD, Chen J, Raskino C, McKinney RE, et al. Genetic influence of CCR5, CCR2, and SDF1 variants on human immunodeficiency virus 1 (HIV-1)-related disease progression and neurological impairment, in children with symptomatic HIV-1 infection. J Infect Dis 2003; 188:1461–1472.

5. Ali S, Niang MA, N'Doye I, Critchlow CW, Hawes SE, Hill AV, et al. Secretor polymorphism and human immunodeficiency virus infection in Senegalese women. J Infect Dis 2000; 181:737–739.

6. Blackwell CC, James VS, Davidson S, Wyld R, Brettle RP, Robertson RJ, et al. Secretor status and heterosexual transmission of HIV. BMJ 1991; 303:825–826.

7. Weiss R, Neil SJD, Gustafsson K, McKnight A. ABO Blood Groups and HIV-1 Infection. XIII International Conference of Virology. San Francisco, July 2005 [abstract 116-V p. 94].

8. Kelly RJ, Rouquier S, Giorgi D, Lennon GG, Lowe JB. Sequence and expression of a candidate for the human Secretor blood group alpha(1,2)fucosyltransferase gene (FUT2). Homozygosity for an enzyme-inactivating nonsense mutation commonly correlates with the non-secretor phenotype. J Biol Chem 1995; 270:4640–4649.

9. Koda Y, Soejima M, Kimura H. The polymorphisms of fucosyltransferases. Leg Med (Tokyo) 2001; 3:2–14.

10. Koda Y, Tachida H, Soejima M, Takenaka O, Kimura H. Ancient origin of the null allele se(428) of the human ABO-secretor locus (FUT2). J Mol Evol 2000; 50:243–248.

11. Candotti D, Costagliola D, Joberty C, Bonduelle O, Rouzioux C, Autran B, et al. Status of long-term asymptomatic HIV-1 infection correlates with viral load but not with virus replication properties and cell tropism. French ALT Study Group. J Med Virol 1999; 58:256–263.

12. Bodman-Smith MD, Williams I, Johnstone R, Boylston A, Lydyard PM, Zumla A. T cell receptor usage in patients with non-progressing HIV infection. Clin Exp Immunol 2002; 130:115–120.

13. Zanussi S, Simonelli C, D'Andrea M, Caffau C, Clerici M, Tirelli U, et al. CD8+ lymphocyte phenotype and cytokine production in long-term non-progressor and in progressor patients with HIV-1 infection. Clin Exp Immunol 1996; 105:220–224.

14. Bratt G, Leandersson AC, Albert J, Sandstrom E, Wahren B. MT-2 tropism and CCR-5 genotype strongly influence disease progression in HIV-1-infected individuals. AIDS 1998; 12:729–736.

15. Leandersson AC, Bratt G, Hinkula J, Gilljam G, Cochaux P, Samson M, et al. Induction of specific T-cell responses in HIV infection. AIDS 1998; 12:157–166.

16. Gustincich S, Manfioletti G, Del Sal G, Schneider C, Carninci P. A fast method for high-quality genomic DNA extraction from whole human blood. Biotechniques 1991; 11:298–300, 302.

17. Ronaghi M, Uhlen M, Nyren P. A sequencing method based on real-time pyrophosphate. Science 1998; 281:363–365.

18. Stern C. The Hardy–Weinberg Law. Science 1943; 97:137–138.

19. Dean M, Carrington M, Winkler C, Huttley GA, Smith MW, Allikmets R, et al. Genetic restriction of HIV-1 infection and progression to AIDS by a deletion allele of the CKR5 structural gene. Hemophilia Growth and Development Study, Multicenter AIDS Cohort Study, Multicenter Hemophilia Cohort Study, San Francisco City Cohort, ALIVE Study. Science 1996; 273:1856–1862.

20. Liu R, Paxton WA, Choe S, Ceradini D, Martin SR, Horuk R, et al. Homozygous defect in HIV-1 coreceptor accounts for resistance of some multiply-exposed individuals to HIV-1 infection. Cell 1996; 86:367–377.

21. Puissant B, Roubinet F, Dellacasagrande J, Massip P, Abbal M, Pasquier C, et al. Decrease of Lewis frequency in HIV-infected patients: possible competition of fucosylated antigens with HIV for binding to DC-SIGN. AIDS 2005; 19:627–630.

22. Reitter JN, Means RE, Desrosiers RC. A role for carbohydrates in immune evasion in AIDS. Nat Med 1998; 4:679–684.

23. Aspholm-Hurtig M, Dailide G, Lahmann M, Kalia A, Ilver D, Roche N, et al. Functional adaptation of BabA, the H. pylori ABO blood group antigen binding adhesin. Science 2004; 305:519–522.

Cited By:

This article has been cited 20 time(s).

Journal of Medical Virology
Ala67Thr Mutation in the Poliovirus Receptor CD155 is a Potential Risk Factor for Vaccine and Wild-Type Paralytic Poliomyelitis
Kindberg, E; Ax, C; Fiore, L; Svensson, L
Journal of Medical Virology, 81(5): 933-936.
10.1002/jmv.21444
CrossRef
Plos One
The G428A Nonsense Mutation in FUT2 Provides Strong but Not Absolute Protection against Symptomatic GII.4 Norovirus Infection
Carlsson, B; Kindberg, E; Buesa, J; Rydell, GE; Lidon, MF; Montava, R; Abu Mallouh, R; Grahn, A; Rodriguez-Diaz, J; Bellido, J; Arnedo, A; Larson, G; Svensson, L
Plos One, 4(5): -.
ARTN e5593
CrossRef
Transfusion
Systematic sequence analysis of the human fucosyltransferase 2 (FUT2) gene identifies novel sequence variations and alleles
Yip, SP; Lai, SK; Wong, ML
Transfusion, 47(8): 1369-1380.
10.1111/j.1537-2995.2007.01280.x
CrossRef
Future Virology
Genetic basis of host resistance to norovirus infection
Kindberg, E; Svensson, L
Future Virology, 4(4): 369-382.
10.2217/FVL.09.14
CrossRef
Blood
The relationship between blood groups and disease
Anstee, DJ
Blood, 115(): 4635-4643.
10.1182/blood-2010-01-261859
CrossRef
Transfusion
Genetic variation of FUT2 in Ovambos, Turks, and Mongolians
Soejima, M; Nakajima, T; Fujihara, J; Takeshita, H; Koda, Y
Transfusion, 48(7): 1423-1431.
10.1111/j.1537-2995.2008.01710.x
CrossRef
Emerging Infectious Diseases
Norovirus Gastroenteritis Outbreak with a Secretor-independent Susceptibility Pattern, Sweden
Nordgren, J; Kindberg, E; Lindgren, PE; Matussek, A; Svensson, L
Emerging Infectious Diseases, 16(1): 81-87.
10.3201/eid1601.090633
CrossRef
Expert Review of Vaccines
Clarification of how HIV-1 DNA and protein immunizations may be better used to obtain HIV-1-specific mucosal and systemic immunity
Hinkula, J
Expert Review of Vaccines, 6(2): 203-212.
10.1586/14760584.6.2.203
CrossRef
Molecular Biology and Evolution
A Natural History of FUT2 Polymorphism in Humans
Ferrer-Admetlla, A; Sikora, M; Laayouni, H; Esteve, A; Roubinet, F; Blancher, A; Calafell, F; Bertranpetit, J; Casals, F
Molecular Biology and Evolution, 26(9): 1993-2003.
10.1093/molbev/msp108
CrossRef
Transfusion
Identification of six new alleles at the FUT1 and FUT2 loci in ethnically diverse individuals with Bombay and para-Bombay phenotypes
Storry, JR; Johannesson, JS; Poole, J; Strindberg, J; Rodrigues, MJ; Yahalom, V; Levene, C; Fujita, C; Castilho, L; Hustinx, H; Olsson, ML
Transfusion, 46(): 2149-2155.
10.1111/j.1537-2995.2006.01045.x
CrossRef
Journal of Internal Medicine
Revisiting human primary immunodeficiencies
Casanova, JL; Fieschi, C; Zhang, SY; Abel, L
Journal of Internal Medicine, 264(2): 115-127.
10.1111/j.1365-2796.2008.01971.x
CrossRef
Journal of Medical Virology
Genetic Susceptibility to Symptomatic Norovirus Infection in Nicaragua
Bucardo, F; Kindberg, E; Paniagua, M; Vildevall, M; Svensson, L
Journal of Medical Virology, 81(4): 728-735.
10.1002/jmv.21426
CrossRef
Clinical Immunology
NK cell activation by KIR-binding antibody 1-7F9 and response to HIV-infected autologous cells in viremic and controller HIV-infected patients
Johansson, SE; Hejdeman, B; Hinkula, J; Johansson, MH; Romagne, F; Wahren, B; Wagtmann, NR; Karre, K; Berg, L
Clinical Immunology, 134(2): 158-168.
10.1016/j.clim.2009.10.001
CrossRef
Journal of Clinical Microbiology
Host genetic resistance to symptomatic norovirus (GGII.4) infections in Denmark
Kindberg, E; Akerlind, B; Johnsen, C; Knudsen, JD; Heltberg, O; Larson, G; Bottiger, B; Svensson, L
Journal of Clinical Microbiology, 45(8): 2720-2722.
10.1128/JCM.00162-07
CrossRef
Journal of Infectious Diseases
A deletion in the chemokine receptor 5 (CCR5) gene is associated with tickborne encephalitis
Kindberg, E; Mickiene, A; Ax, C; Akerlind, B; Vene, S; Lindquist, L; Lundkvist, A; Svensson, L
Journal of Infectious Diseases, 197(2): 266-269.
10.1086/524709
CrossRef
Glycobiology
Fucosylation in prokaryotes and eukaryotes
Ma, B; Simala-Grant, JL; Taylor, DE
Glycobiology, 16(): 158R-184R.
10.1093/glycob/cwl040
CrossRef
Lancet Infectious Diseases
Genetic susceptibility to infectious diseases: big is beautiful, but will bigger be even better?
Burgner, D; Jamieson, SE; Blackwell, JM
Lancet Infectious Diseases, 6(): 653-663.

Seminars in Immunology
Mendelian resistance to human norovirus infections
Le Pendu, J; Ruvoen-Clouet, N; Kindberg, E; Svensson, L
Seminars in Immunology, 18(6): 375-386.
10.1016/j.smim.2006.07.009
CrossRef
Clinica Chimica Acta
Taq Man real-time polymerase chain reaction for detection of SEC1-FUT2 hybrid alleles: Identification of novel hybrid allele
Soejima, M; Koda, Y
Clinica Chimica Acta, 415(): 59-62.
10.1016/j.cca.2012.08.020
CrossRef
AIDS
Orally exposed uninfected individuals have systemic anti-HIV responses associating with partners' viral load
Hasselrot, K; Bratt, G; Hirbod, T; Säberg, P; Ehnlund, M; Lopalco, L; Sandström, E; Broliden, K
AIDS, 24(1): 35-43.
10.1097/QAD.0b013e3283329853
PDF (387) | CrossRef
Back to Top | Article Outline
Keywords:

secretor status; HIV-1; LTNP; FUT2; H-antigen; CCR5

© 2006 Lippincott Williams & Wilkins, Inc.

Login

Search for Similar Articles
You may search for similar articles that contain these same keywords or you may modify the keyword list to augment your search.