Introduction
A-type lamins, encoded by the LMNA gene, are intermediate filament proteins thought to contribute to the structural integrity of the nucleus. In most differentiated cells, A-type lamins (predominantly lamins A and C and referred to as lamin A/C), along with the B-type lamins are the major components of the nuclear lamina, a proteinacious matrix underlying the inner nuclear membrane [1,2]. Over 100 mutations in the LMNA gene have been linked to numerous human genetic disorders, termed laminopathies [3,4]. These include progeroid syndromes and dystrophic syndromes with pathologies restricted to muscle or fat tissue. The lipodystrophic syndromes, Dunnigan-type autosomal dominant familial partial lipodystrophy (FPLD) and mandibuloacral dysplasia (MAD), are characterized by wasting of subcutaneous fat in the trunk and extremities, variable and regionalized fat excess, diabetes mellitus with peripheral insulin resistance, hyperinsulinemia and hypertriglyceridemia [5]. In addition to FPLD and MAD, Hutchison-Gilford Progeria Syndrome (HGPS) is accompanied by a striking paucity of adipose tissue.
Lamin A is synthesized as a 664-amino acid protein, prelamin A. Lamin A maturation requires a sequential process whereby its C-terminal CaaX motif is prenylated, followed by cleavage after the cysteine and carboxy-methylation [6]. Finally, a second cleavage event removes another 15 C-terminal amino acids, including the modified cysteine (see Fig. 4a).
Several lines of evidence suggest that disruption of prelamin A processing leads to fat pathologies and metabolic disturbances. For example, MAD results from homozygous mutation of either LMNA or the metalloprotease required for the lamin A maturation, Zmpste24 [7,8]. Lipodystrophic phenotypes have also been reported for mice lacking Zmpste24 [9]. As prelamin A is the only known substrate of Zmpste24, accumulation of prelamin A probably underlies the deleterious effects of loss of Zmpste24 [10,11]. Furthermore, at least one HGPS-associated LMNA allele is likely to interfere with maturation. Since Lmna-/- mice acquire muscular dystrophy but not lipodystrophy [12,13], we hypothesize that lipodystrophic syndromes result from novel or altered activities conferred either by missense mutations in LMNA or by the presence of unprocessed C-terminal prelamin A tails.
Within the spectrum of congenital lipodystophic syndromes, those associated with LMNA stand out as phenotypically unique. However, FPLD does bear striking clinical similarity to the lipodystrophic syndrome associated with the HIV protease inhibitors indinavir and nelfinavir. As many as 80% of HIV patients on high activity antiretroviral therapy (HAART) develop a lypodystrophy that, like FPLD, presents both peripheral lipoatrophy, central lipohypertrophy, and insulin resistance [14]. These similarities have generated speculation that the side effects of the HIV protease inhibitors may be mediated by lamin A [15-17]. More precisely, HIV protease inhibitors may interfere with processing of prelamin A by Zmpste24.
In vitro, indinavir and nelfinavir potently block the conversion of pre-adipocytes to adipocytes, providing mechanistic insight into the effects of HIV protease inhibitors on adipose tissue [18]. Recently, Caron et al. demonstrated that treatment of pre-adipocytes with indinavir or nelfinavir stimulates prelamin A accumulation and nuclear morphology defects consistent with disruption of lamin A/C activity [16]. In light of these observations, we have tested the hypothesis that the anti-adipogenic activity of indinavir and nelfinavir results from their ability to interfere with lamin A maturation. Furthermore, we have evaluated the consequences of stable expression of lipodystrophy-associated and processing defective lamin A mutants on adipogenesis in vitro.
Methods
Plasmids
To direct high-level expression of lamin A mutants in 3T3-L1 cells, a mouse stem cell virus (MSCV) based vector was constructed. The phosphoglycerate kinase promoter driving expression of the hygromycin resistance marker in retroviral vector pMSCVhyg (Clontech, Mountain View, California, USA) was replaced with the internal ribosome entry site (IRES) from the expression vector pIREShyg3 (Clontech). Briefly, pIREShyg3 was cut with NotI, blunted with Klenow and then digested with NcoI. The resulting 1.1-kilobase pair fragment was ligated into pMSCVhyg cut with HpaI/NcoI. The multicloning site was replaced with an oligonucleotide containing BamHI/HpaI/XhoI sites to yield pMXIH. cDNAs encoding wild-type and mutant human lamin A proteins were subcloned into pMXIH from Bluescript (Stratagene, La Jolla, California, USA) with BamHI and XhoI. In all cases, lamin A and mutants of lamin A were expressed as prelamin A (including the 18 amino acids that are eventually cleaved) and allowed to be processed naturally by the target cell. For expression of stabilizied β-catenin, a BamHI/EcoRI fragment, from pXBC69 (D. Kimelman, University of Washington), encoding myc-tagged β-catenin from Xenopus laevis with S33A, S37A, T41A, and S45A substitutions was subcloned into Bluescript to make pBS-XBC4A [19]. A BamHI-SalI fragment from pBS-XBC4A was ligated into pMXIH cut with BamHI and XhoI to yield pMXIH-XBC4A.
Retroviral small inhibitory RNA (siRNA) constructs were generated by ligating annealed oligonucleotides (mouse lamin A/C GATCCCCGCTTGACTTCCAGAAGAACATTTCAAGAGAATGTTCTTCTGGAAGTCAAGCTTTTTGGAAA, mouse emerin GATCCCCGGACTATAATGATGACTACTTCAAGAGAGTAGTCATCATTATAGTCCTTTTTGGAAA, enhanced green fluorescent protein (eGFP) gatccccgcggcacgacttcttcaagttcaagagacttgaagaagtcgtgccgctttttggaaa) into pSuper.retro-Puro (Oligoengine, Seattle, Washington, USA) cut with HindIII/BglII.
Cell culture and retroviruses
3T3-L1 pre-adipocytes (ATCC) were cultured in growth media (GM), Dulbecco's Modified Eagle Media (DMEM) supplemented with 10% calf serum, 2 mM L-glutamine, 10 U/ml penicillin, 10 μg/ml streptomycin. Cells were differentiated essentially as previously described [20]. Briefly, cells were grown to contact inhibition in GM. Two days postconfluency, differentiation was induced with insulin (1 μg/ml), dexamethasone (1 μM) and isobutylmethylxanthine (1.15 mg/ml) in DMEM supplemented with 10% fetal bovine serum (FBS), L-glutamine and penicillin-streptomycin. Two days postinduction, cells were transferred to DMEM with FBS containing insulin (1 μg/ml) and cells were subsequently fed every 2 days with DMEM and FBS.
In all cases, adipocytes were lysed 6 days postinduction by boiling in 1% SDS, 50 mM Tris pH 6.8 and 1 mM dithiothreitol, and parallel cultures of adipoctyes were fixed and stained with Oil Red-O 8 days after induction to mark differentiated adipocytes.
To express wild-type and mutant lamin A and stabilized β-catenin, 293T cells were co-transfected by calcium phosphate co-precipitation with the pMXIH-based plasmids and an ecotropic packaging plasmid. Thirty-six hour post-transfection, viral supernatants were harvested in GM and used to infect 3T3-L1 pre-adipocytes twice in 24 h. Thirty-six hours after the last infection, cells were transferred to selective media containing 300 μg/ml hygromycin-B. Cells were selected in hygromycin-B for 5 days, then grown to confluency in selection for 3 more days. Selection was removed upon induction of differentiation.
Ecotropic retrovirus generated from the pSuper.retro-Puro plasmids was prepared as above. 3T3-L1 pre-adipocytes were infected with retrovirus titred such that the multiplicity of infection was less than one event per cell. Twenty-four hours postinfection, cells were selected in 5 μg/ml puromycin for 60 h. These cells were used for experiments no more than five passages after selection.
For treatment of 3T3-L1 cells with HIV protease inhibitors (from the NIH AIDS Research and Reference Reagent Program), indinavir (at 50 μg/ml, unless otherwise indicated) or nelfinavir (at 10 μg/ml) was added to the media when cells reached contact inhibition. The drug was maintained in the media throughout differentiation and was replenished every second day when new media was added.
Antibodies and immunofluoresence
Antibodies used in this study were: rabbit anti-pan lamin A/C (Cell Signaling, 2032, Beverly, Massachusetts, USA), mouse anti-human lamin A/C (Santa Cruz, SC-7292, Santa Cruz, California, USA), goat anti-prelamin A (Santa Cruz, SC-6214, Temecula, California, USA), mouse anti-actin (Chemicon, MAB1501R), rabbit anti-emerin (Santa Cruz, SC-15378), human anti-fibrillarin (M. Pollard, Salk Institute, La Jolla, California, USA), rabbit anti-lamin B1 (Santa Cruz, SC-20682).
Immunofluorescence was performed on formaldehyde fixed pre-adipocytes as previously described [21]. Images were captured on a Zeiss Axiovert 200 (Obserkochen, Germany).
Results
Dominant lipodystrophy-associated LMNA mutants do not inhibit 3T3-L1 differentiation
Because FPLD is a genetically dominant disorder with pathologies in fat tissue, we hypothesized that lamin A proteins encoded by FPLD-specific alleles of LMNA would exhibit gain-of-function activities that interfere with the function of fat cells. To determine the consequences of expression of dominant FPLD-associated lamin A mutants on fat cell differentiation, we chose representative point mutants, R62G, R482W, and R584H, one from each of the three regions of the protein about which FPLD mutations cluster. 3T3-L1 pre-adipocytes were stably transduced with retroviruses carrying either empty vector (pMXIH), wild-type human lamin A, the lipodystrophy mutants, or the R453W Emery-Dreifuss Muscular Distrophy (EDMD)-associated mutant. As a positive control for block to differentiation, one set of cells was transduced with stabilized Xenopus β-catenin, also expressed from pMXIH [22]. Whereas stabilized β-catenin potently blocked conversion of pre-adipocytes to adipocytes, as judged by Oil Red-O staining, cells transduced with each of the lamin A mutants differentiated at levels indistinguishable from cells transduced with empty vector or wild-type lamin A (Fig. 1a). Quantitation of adipocytes was determined by counting the percentage of lipid-positive cells after 8 days of differentiation (Fig. 1b). Western analysis indicated that each of the lamin A constructs was expressed at levels comparable to the endogenous mouse lamin A protein (Fig. 1c).
Reduction of lamin A/C but not emerin results in compromised nuclear morphology
We next determined the consequences of reducing the expression of lamin A/C or its binding partner emerin in 3T3-L1 pre-adipocytes. Proliferating 3T3-L1 pre-adipocytes were infected with titre-matched retroviruses expressing siRNA directed against the mRNA for lamin A/C, emerin, or, as a control, enhanced green fluorescent protein (EGFP). Following selection of infected cells in puromycin, pre-adipocytes were lysed and reduction of lamin A/C and emerin protein was confirmed by western blot (Fig. 2a). Each cell line was then assayed for defects in nuclear morphology by staining for lamin B1, the nucleolus and DNA (with DAPI-diamidino-2phenylindole hydrochloride). Nuclei were scored as dysmorphic if they showed blebbing, sharp edges or invaginations. Whereas cells carrying siRNA directed to EGFP or emerin showed similar percentages of dysmorphic nuclei to control cells, cells in which lamin A/C levels were reduced by siRNA showed a twofold increase in the percentage of cells with dysmorphic nuclei and a threefold increase in cells with nuclear blebbing (Fig. 2b and c). These data indicate that although lamin A/C is not completely ablated, we observe functional consequences consistent with loss of its function. That emerin reduction does not compromise nuclear integrity is surprising, although we are not aware of nuclear structural defects being reported for cells with compromised emerin function.
Reduction of lamin A/C does not compromise 3T3-L1 differentiation
To determine if lamin A/C or emerin is required for efficient adipocyte differentiation, 3T3-L1 pre-adipocytes stably expressing EGFP, Lmna, or Emerin siRNA were grown to confluence and induced to differentiate. Cells expressing EGFP and Lmna siRNA differentiated with efficiencies comparable to control, uninfected 3T3-L1 cells (Fig. 3a and b). This suggests that reduced activity of lamin A/C, which may mimic a situation in which one allele of LMNA is mutated to a loss of function, does not affect the ability of fat cells to differentiate in vitro. Furthermore, as we observed an increase in dysmorphic nuclei but no change in differentiation following lamin A/C reduction, these data suggest that nuclear fragility is probably insufficient to induce the lipodystrophic pathologies. Surprisingly, we consistently observe a modest, but reproducible reduction in the percent of differentiated adipocytes following Emerin silencing (Fig. 3a and b). The significance of this finding is unclear at present.
Accumulation of prelamin A does not affect 3T3-L1 differentiation
Several lines of evidence suggest that abnormal processing of lamin A is associated with adipose tissue dysfunction in humans and mice. To determine if aberrant prelamin A processing inhibits 3T3-L1 differentiation, we stably expressed three processing defective lamin A mutants in these cells. The C661S mutant converts the sulfhydryl group that normally accepts the prenyl modification to hydroxyl group, yielding a prelamin A protein that is refractory to prenylation (Fig. 4a). Because prelamin A is processed in steps, each of which is dependent upon the preceding step, this mutation is predicted to block all processing events. Western analysis with a prelamin A antibody revealed that C661S lamin A is indeed unprocessed and migrates at the size expected of the 664 amino acid prelamin A (Fig. 4b). The L647R mutation has been shown to block the internal cleavage event of prelamin A, resulting in a lamin A molecule that retains the 15 amino acids and prenyl group normally removed by the action of the second-site protease [23]. Western analysis demonstrated that this molecule was expressed, was reactive with a prelamin A-specific antibody, and migrated slightly faster than the C661S mutant, indicating that the first cleavage event occurs efficiently (Fig. 4b). In addition to the two point mutants, we also expressed an allele comparable to the G608G HGPS allele of lamin A (termed G608G*), that, due to aberrant splicing removes 50 amino acids in the C terminus including the second cleavage site [24]. This deletion eliminates a portion of the epitope recognized by the prelamin A antibody, but the protein was detectable at its predicted size by a pan lamin A/C antibody. As controls, we also overexpressed wild-type lamin A or stabilized β-catenin in 3T3-L1 cells. Interestingly, overexpression of wild-type lamin A, resulted in signal detectable by the prelamin A antibody, probably due to saturation of the processing machinery by excess prelamin A.
We found that none of the three mutants described above (C661S, L647R, or G608G*) alter adipocyte differentiation as judged qualitatively by Oil Red-O staining (data not shown) or quantitatively by determining the percentage of cells containing lipid droplets (Fig. 4d). In contrast, vector-transduced cells treated with indinavir reveal a small accumulation of prelamin A, but the efficiency of differentiation is reduced about fourfold compared to cells treated with no drug (Fig. 4c and d). Together, our findings suggest that altering A-type lamin function by reducing expression of lamin A/C, or by expressing either lipodystrophy-specific mutant alleles or processing-defective alleles has no bearing on the ability of 3T3-L1 cells to undergo adipocyte conversion.
Prelamin A accumulation is not required for the anti-adipogenic activity of HIV protease inhibitors
As shown above, expression of high levels of unprocessed lamin A, either by overexpressing wild-type lamin A or by expressing processing defective alleles, does not block 3T3-L1 differentiation. This finding casts doubt on the appealing but previously untested hypothesis that HAART-related protease inhibitors give rise to lipodystrophic phenotypes by stimulating the accumulation of prelamin A. To examine the potential links between HAART-related protease inhibitors and lamin A processing more directly, we tested whether the ability of HIV protease inhibitors to stimulate the accumulation of prelamin A is required for their anti-adipogenic activity. Indinavir and other protease inhibitors have been shown to potently inhibit adipocyte differentiation of 3T3-L1 cells [18]. Given that reduction of lamin A/C protein levels by siRNA had no affect on the ability of 3T3-L1 cells to differentiate, we reasoned that if accumulation of prelamin A is central to the anti-adipogenic mechanism of indinavir, then cells in which lamin A/C was reduced should be resistant to the block to differentiation caused by indinavir and nelfinavir. 3T3-L1 cells stably expressing siRNA directed to Lmna, Emerin or EGFP were induced to differentiate in the presence or absence of indinavir. At 6 days postinduction cells were lysed and levels of prelamin A were determined (Fig. 5a). As expected, in cells carrying EGFP or emerin siRNA, indinavir stimulated the accumulation of prelamin A. However, in cells carrying the lamin A/C siRNA, no prelamin A was detectable either in the presence or absence of indinavir. Oil Red-O staining of the cells at 8 days postinduction, however, revealed that indinavir was equally effective at blocking 3T3-L1 differentiation in cells carrying each of the three siRNA (Fig. 5b). Similar results were observed with nelfinavir (data not shown). As a further control, the inhibitory effects of indinavir were examined at three different drug concentrations, which lead to mild, moderate or potent inhibition of adipocyte conversion. Once again we found that the lamin A/C-depleted cells behaved indistinguishably from control siRNA-expressing cells at all three drug concentrations (Fig. 5c). Together, our findings indicate that HIV protease inhibitors effectively block 3T3-L1 differentiation in the absence of detectable prelamin A, demonstrating that unprocessed lamin A is not required for the anti-adipogenic affects of indinavir in vitro and suggesting that it may not be required for the lipodystrophic side effects of patients undergoing HAART therapy.
Discussion
The HIV protease inhibitors indinavir and nelfinavir have been shown to potently block fat cell differentiation in vitro, and this is known to be correlated with the accumulation of unprocessed lamin A and disturbances in nuclear morphology qualitatively similar to those observed in fibroblasts derived from patients carrying LMNA mutations [16]. Given these data, and the association of LMNA and ZMPSTE24 mutations with lipodystrophic syndromes resembling that experienced by HIV patients on HAART, we tested the hypothesis that the side effects of HIV protease inhibitors are mediated through A-type lamins. Using lamin A mutants blocked at various stages of maturation, we have shown that the presence of unprocessed lamin A is, itself, not sufficient to block 3T3-L1 conversion. Furthermore, by reducing lamin A/C to levels such that prelamin A accumulation in response to indinavir is undetectable, we show that the ability of HIV protease inhibitors to cause the accumulation of prelamin A is not central to their anti-adipogenic activity. Thus although prelamin A accumulation is clearly associated with treatment of pre-adipocytes with HIV protease inhibitors, it is unlikely to play a role in the anti-adipogenic activity of these drugs.
Although our data indicate that the anti-adipogenic activity of HIV protease inhibitors in vitro is independent of lamin A/C, it remains a distinct possibility that altered lamin A processing in vivo is related to the lipodystrophy associated with HIV protease inhibitors. However, in addition to altering lamin A processing, the HIV protease inhibitors have been shown to block the nuclear translocation of the SREBP-1 transcription factor [16,25]. As SREBP-1 is a lamin A-binding protein [26], we initially reasoned that the presence of prelamin A or lipodystrophy-associated lamin A mutants might exert dominant activities that interfere with the function of SREBP-1 in the nucleus. Instead, our findings suggest that altered lamin A processing and disrupted nuclear morphology may be secondary to other cellular changes, possibly including altered SREBP-1 activity.
In this work we have also attempted to define the role of lamin A/C in the differentiation of adipocytes in vitro. We hypothesized that LMNA mutations associated with FPLD would exhibit dominant gain-of-function activities that would interfere with the ability of adipocytes to differentiate. Our findings, using stable, high-level overexpression of three FPLD-associated lamin A alleles, failed to reveal any dominant anti-adipogenic activity of FPLD-derived lamin A mutants.
This observation contrasts with the finding that a dominant EDMD-associated (R453W) lamin A mutant blocked the ability of C2C12 myoblasts to differentiate into myotubes [27].
Additionally, we modeled a situation in which lamin A/C function is reduced, as may be the case in heterozygous loss-of-function mutations, by inhibiting expression with siRNA. Although we were able to detect functional consequences of stable lamin A/C depletion on the nuclear morphology of 3T3-L1 pre-adipocytes, this did not correlate with changes in their adipogenic potential. This finding once again differs from what is observed in muscle where reduction of lamin A/C expression inhibits the ability of myoblasts to differentiate (R. Frock, S. Hauschka, and B. K. Kennedy, unpublished data). These data suggest that, in contrast to muscular dystrophy, the lipodystrophy is not effectively modeled with in vitro differentiation systems. One possible explanation for these findings is that the defects in fat cell function in vivo are an indirect manifestation of an endocrine defect resulting from dysfunction of a non-fat tissue where lamin A/C plays a crucial role. Alternatively, the process of lipoatrophy may be unrelated to that of adipocyte differentiation.
Given that A-type lamin expression is restricted to later periods in embryonic development where differentiation of specific cell types is occurring, it has been speculated that these nuclear structural proteins function to assist cell specification or maintain cells in a differentiated state [1,28]. Our findings, coupled with those in muscle cells, indicate that the importance of lamin A/C for differentiation is likely to be tissue specific. Thus it is important to identify the range of tissues where A-type lamins coordinate differentiation, as they are mostly likely to underlie specific lipodystrophy- and progeria-associated phenotypes. Although HIV protease inhibitors in principle could confer lipoatrophy phenotypes by interfering with lamin A processing in non-adipose tissue, we conclude that the side effects attributed to prolonged HAART therapy are likely unrelated to lamin A processing.
Acknowledgements
Indinavir and nelfinavir were provided by the NIH AIDS Research and Reagent Reference Program. The authors thank Richard Palmiter, Erica Smith and members of the Kennedy lab for thoughtful discussions, David Kimelman and Wilson Clements for providing the β-catenin cDNA.
Sponsorship: BAK is supported in part by PHS NRSA T32 GM07270 from NIGMS. This research was supported by National Institutes of Health grant R01AG024287 to BKK. BKK is a Searle Scholar.
References
1. Smith ED, Kudlow BA, Frock RL, Kennedy BK. A-type nuclear lamins, progerias and other degenerative disorders. Mech Ageing Dev 2005; 126:447-460.
2. Zastrow MS, Vlcek S, Wilson KL. Proteins that bind A-type lamins: integrating isolated clues. J Cell Sci 2004; 117:979-987.
3. Muchir A, Worman HJ. The nuclear envelope and human disease. Physiology (Bethesda) 2004; 19:309-314.
4. Mounkes L, Kozlov S, Burke B, Stewart CL. The laminopathies: nuclear structure meets disease. Curr Opin Genet Dev 2003; 13:223-230.
5. Kobberling J, Dunnigan MG. Familial partial lipodystrophy: two types of an X linked dominant syndrome, lethal in the hemizygous state. J Med Genet 1986; 23:120-127.
6. Weber K, Plessmann U, Traub P. Maturation of nuclear lamin A involves a specific carboxy-terminal trimming, which removes the polyisoprenylation site from the precursor; implications for the structure of the nuclear lamina. FEBS Lett 1989; 257:411-414.
7. Novelli G, Muchir A, Sangiuolo F, Helbling-Leclerc A, D'Apice MR, Massart C, et al. Mandibuloacral dysplasia is caused by a mutation in LMNA-encoding lamin A/C. Am J Hum Genet 2002; 71:426-431.
8. Agarwal AK, Fryns JP, Auchus RJ, Garg A. Zinc metalloproteinase, ZMPSTE24, is mutated in mandibuloacral dysplasia. Hum Mol Genet 2003; 12:1995-2001.
9. Pendas AM, Zhou Z, Cadinanos J, Freije JM, Wang J, Hultenby K, et al. Defective prelamin A processing and muscular and adipocyte alterations in Zmpste24 metalloproteinase-deficient mice. Nat Genet 2002; 31:94-99.
10. Bergo MO, Gavino B, Ross J, Schmidt WK, Hong C, Kendall LV, et al. Zmpste24 deficiency in mice causes spontaneous bone fractures, muscle weakness, and a prelamin A processing defect. Proc Natl Acad Sci USA 2002; 99:13049-13054.
11. Fong LG, Ng JK, Meta M, Cote N, Yang SH, Stewart CL, et al. Heterozygosity for Lmna deficiency eliminates the progeria-like phenotypes in Zmpste24-deficient mice. Proc Natl Acad Sci USA 2004; 101:18111-18116.
12. Sullivan T, Escalante-Alcalde D, Bhatt H, Anver M, Bhat N, Nagashima K, et al. Loss of A-type lamin expression compromises nuclear envelope integrity leading to muscular dystrophy. J Cell Biol 1999; 147:913-920.
13. Cutler DA, Sullivan T, Marcus-Samuels B, Stewart CL, Reitman ML. Characterization of adiposity and metabolism in Lmna-deficient mice. Biochem Biophys Res Commun 2002; 291:522-527.
14. Behrens GM, Stoll M, Schmidt RE. Lipodystrophy syndrome in HIV infection: what is it, what causes it and how can it be managed? Drug Saf 2000; 23:57-76.
15. Behrens GM, Genschel J, Schmidt RE, Schmidt HH. Lack of mutations in LMNA, its promoter region, and the cellular retinoic acid binding protein II (CRABP II) in HIV associated lipodystrophy. Eur J Med Res 2003; 8:221-225.
16. Caron M, Auclair M, Sterlingot H, Kornprobst M, Capeau J. Some HIV protease inhibitors alter lamin A/C maturation and stability, SREBP-1 nuclear localization and adipocyte differentiation. AIDS 2003; 17:2437-2444.
17. Behrens GM, Lloyd D, Schmidt HH, Schmidt RE, Trembath RC. Lessons from lipodystrophy: LMNA, encoding lamin A/C, in HIV therapy-associated lipodystrophy. AIDS 2000; 14:1854-1855.
18. Zhang B, MacNaul K, Szalkowski D, Li Z, Berger J, Moller DE. Inhibition of adipocyte differentiation by HIV protease inhibitors. J Clin Endocrinol Metab 1999; 84:4274-4277.
19. Yost C, Torres M, Miller JR, Huang E, Kimelman D, Moon RT. The axis-inducing activity, stability, and subcellular distribution of beta-catenin is regulated in Xenopus embryos by glycogen synthase kinase 3. Genes Dev 1996; 10:1443-1454.
20. Student AK, Hsu RY, Lane MD. Induction of fatty acid synthetase synthesis in differentiating 3T3-L1 preadipocytes. J Biol Chem 1980; 255:4745-4750.
21. Kennedy BK, Barbie DA, Classon M, Dyson N, Harlow E. Nuclear organization of DNA replication in primary mammalian cells. Genes Dev 2000; 14:2855-2868.
22. Ross SE, Hemati N, Longo KA, Bennett CN, Lucas PC, Erickson RL, et al. Inhibition of adipogenesis by Wnt signaling. Science 2000; 289:950-953.
23. Hennekes H, Nigg EA. The role of isoprenylation in membrane attachment of nuclear lamins. A single point mutation prevents proteolytic cleavage of the lamin A precursor and confers membrane binding properties. J Cell Sci 1994; 107:1019-1029.
24. Eriksson M, Brown WT, Gordon LB, Glynn MW, Singer J, Scott L, et al. Recurrent de novo point mutations in lamin A cause Hutchinson-Gilford progeria syndrome. Nature 2003; 423:293-298.
25. Caron M, Auclair M, Vigouroux C, Glorian M, Forest C, Capeau J. The HIV protease inhibitor indinavir impairs sterol regulatory element-binding protein-1 intranuclear localization, inhibits preadipocyte differentiation, and induces insulin resistance. Diabetes 2001; 50:1378-1388.
26. Lloyd DJ, Trembath RC, Shackleton S. A novel interaction between lamin A and SREBP1: implications for partial lipodystrophy and other laminopathies. Hum Mol Genet 2002; 11:769-777.
27. Favreau C, Higuet D, Courvalin JC, Buendia B. Expression of a mutant lamin A that causes Emery-Dreifuss muscular dystrophy inhibits in vitro differentiation of C2C12 myoblasts. Mol Cell Biol 2004; 24:1481-1492.
28. Rober RA, Weber K, Osborn M. Differential timing of nuclear lamin A/C expression in the various organs of the mouse embryo and the young animal: a developmental study. Development 1989; 105:365-378.
© 2005 Lippincott Williams & Wilkins, Inc.