Skip Navigation LinksHome > May 20, 2005 - Volume 19 - Issue 8 > High levels of HPV-16 DNA are associated with high-grade cer...
AIDS:
Clinical Science

High levels of HPV-16 DNA are associated with high-grade cervical lesions in women at risk or infected with HIV

Fontaine, Juliea,b; Hankins, Catherinec,d; Mayrand, Marie-Hélènea; Lefevre, Jonasa; Money, Deborahe; Gagnon, Simona,b; Rachlis, Anitaf; Pourreaux, Karinad; Ferenczy, Alexg; the Canadian Women's HIV Study Group; Coutlée, Françoisa,b,c

Free Access
Article Outline
Collapse Box

Author Information

From the aLaboratoire de Virologie Moléculaire, Centre de Recherche du Centre Hospitalier de l’Université de Montréal, Montréal, Québec, Canada

bDépartement de Microbiologie et Immunologie, Université de Montréal, Montréal, Québec, Canada

cDepartments of Epidemiology, Biostatistics and Occupational Medicine, Pathology, and Oncology, McGill University, Montreal, Québec, Canada

dDirection de la Santé Publique de Montréal-Centre, Institut National de Santé Publique du Québec, Montréal, Québec, Canada

eDepartment of Obstetrics and Gynecology, University of British Columbia, Vancouver, BC, Canada

fDepartment of Epidemiology and Biostatistics, University of Toronto, Toronto, Ontario, Canada

gDepartment of Pathology and Obstetrics and Gynecology, the Sir Mortimer B. Davis-Jewish General Hospital and McGill University, Montreal, Québec, Canada.

Received 29 July, 2004

Revised 13 December, 2004

Accepted 12 January, 2005

Correspondence to François Coutlée, Département de Microbiologie et Infectiologie, Hôpital Notre-Dame du Centre Hospitalier de l’Université de Montréal, 1560 Sherbrooke est, Montréal, Québec, H2L 4M1, Canada. Tel: +1 514 890 8000, 25162; fax: +1 514 412 7512; e-mail: francois.coutlee@ssss.gouv.qc.ca

Collapse Box

Abstract

Objective: To examine associations between levels of episomal and integrated human papillomavirus (HPV) 16 DNA and the grade of cervical disease.

Design: Cross-sectional data were obtained from a cohort of women with and without HIV infection and with high-risk sexual behaviour.

Methods: Episomal and integrated HPV-16 DNA loads were measured in cervicovaginal lavages collected from 75 women (58 HIV seropositive, 17 HIV seronegative) using real-time polymerase chain reaction assays, controlling for cell content and the presence of inhibitors.

Results: HPV-16 viral loads were significantly higher in women with high-grade squamous intraepithelial lesions (n = 6) than in women with normal cytology (n = 44), whether total (108.28 versus 105.10 HPV-16 DNA copies/μg DNA), episomal (107.99 versus 104.61) or integrated (107.95 versus 104.77) HPV-16 viral loads were measured (P < 0.02 for each comparison). Thirty-nine women had colposcopy [11 normal cervix, 16 cervical intraepithelial neoplasia (CIN) 1, six CIN 2, six CIN 3] and 24 additional women had three consecutive normal cytology smears. Controlling for age, race, CD4 cell count and HIV status, total (OR 3.5, 95% CI 1.2–10.4; P = 0.02), episomal (OR 2.9, 95% CI 1.2–7.4; P = 0.02,) and integrated (OR 1.6, 95% CI 1–2.6; P = 0.05) HPV-16 DNA loads were significantly associated with CIN 2,3, but the differences between CIN 1 and CIN 2,3 were not significant (P > 0.06). A greater amount of cellular DNA was collected from women with CIN 2,3 (P = 0.007).

Conclusion: Higher HPV-16 DNA loads are associated with cervical lesions detected by either histology or cytology. No additional information is gained by measuring integrated or episomal over total HPV-16 DNA loads.

Back to Top | Article Outline

Introduction

Women infected with HIV are at greater risk of anogenital human papillomavirus (HPV) infection and HPV-induced squamous intraepithelial lesions (SIL), as detected by cytology, or cervical intraepithelial neoplasia (CIN), as detected by histology [1–3]. HPV-16 is among the most common genotype detected in women without lesion whether infected or not with HIV, and accounts for half of cervical cancers and high-grade CIN (CIN 2,3) [4–6]. As most HIV-seropositive women are infected with HPV [7], biomarkers that could help identify women at greater risk of CIN progression would be desirable. Several studies have suggested that a high HPV-DNA viral load could be a candidate marker for cervical CIN in HIV-seronegative [8–10] and HIV-seropositive [11–14] women. Increased quantities of integrated HPV-16 DNA have also been reported in CIN 2,3 [15]. HPV integration is considered to be a key event in the progression of cervical lesions to cancer [16,17]. HPV-16 integration was recently demonstrated in early stages of CIN [15,18,19].

The role of HPV-16 viral load and HPV-16 integration in the screening of cervical lesions remains unclear. HPV-16 integration has not been studied in HIV-seronegative women without CIN, and has not been evaluated in HIV-seropositive women with or without CIN. To define the association between HPV-16 viral load, integration and cervical disease, we measured episomal and integrated HPV-16 DNA with real-time polymerase chain reaction (PCR) assays on specimens collected in the course of a cohort study examining the natural history of HPV infection in HIV-seropositive and seronegative women. Our results suggest that HPV-16 DNA viral load is greater in women with cervical disease. Specimens from women without lesion, however, contained a mixture of integrated and episomal forms, impeding the potential usefulness of these real-time PCR tests to predict CIN progression.

Back to Top | Article Outline

Materials and methods

Study population and study design

Subjects were selected from women infected with HPV-16 participating in the Canadian Women's HIV Study between May 1993 and March 2002. The Canadian Women's HIV Study is a cross-sectional and cohort study that investigates determinants of HPV persistence in women infected or at risk of HIV [20–22]. As described elsewhere, 1055 women were enrolled from sexually transmitted disease, primary care clinics, and outpatient HIV care clinics across Canada. Women were eligible if they provided written informed consent, were seropositive for HIV, or were seronegative for HIV but at risk of sexually transmitted diseases [20,22]. A standardized questionnaire was administered upon study entry and at 6-month intervals for all participants. At each visit, a vaginal tampon specimen was obtained as previously described [21]. A Pap smear was then obtained by the use of a cytobrush and Ayres spatula, and cervicovaginal lavage (CVL) was performed with 10 ml sterile phosphate-buffered saline sprayed on the ectocervix with a syringe. Cell suspensions were lysed with 0.8% Tween and digested with proteinase K [21]. An aliquot of 5 μl from each processed sample was amplified for β-globin DNA with PC04-GH20 [21]. β-Globin-positive samples were tested for HPV DNA detection and typing using the MY09–MY11–HMB01 consensus L1 PCR and type-specific probes [21,23].

For all HIV-seropositive women, CD4 cell counts, Pap smears, vaginal tampons and CVL were obtained upon study entry and at 6-month intervals [20,21]. For HIV-seronegative women, vaginal tampons were obtained at inclusion and at 6-month intervals, whereas CVL and Pap smears were collected at one-year intervals. Cytology smears were interpreted in one central pathology laboratory and confirmed by one pathologist using the 1991 Bethesda classification [24]. Colposcopy was performed systematically to participants with high-grade squamous intraepithelial lesions (HSIL) on cytology smears and was suggested to participants with smears showing low-grade squamous intraepithelial lesions (LSIL). Colposcopy and biopsy results were made available to the study investigators. Of the 732 HIV-seropositive and 323 HIV-seronegative women screened for cervical HPV infection at their initial study visits, 366 HPV-infected women (207 HIV-seropositive with a mean of follow-up of 27.3 months, 159 HIV-seronegative with a mean follow-up of 17.9 months) were followed prospectively.

Overall, 132 (12.5%) of 1055 women had at least one CVL containing HPV-16 DNA at baseline or during follow-up visits. For the current publication, data were limited to 75 women (58 HIV seropositive, 17 HIV seronegative): 39 had colposcopy, 24 had over a period of at least 12 months three consecutive normal smears, seven had two or more consecutive smears with LSIL, two had one smear with HSIL, and three were infected by an African or Asian variant. None of the 57 HPV-16-positive women excluded from the study had had colposcopy, 26 had completed one visit only, two had completed two visits only, 12 provided normal smears but at fewer than three visits, nine did not provide Pap smears, six were HPV-16 positive at the last visit only, and two had large intervals between visits greater than 1.5 years.

Back to Top | Article Outline
Real-time polymerase chain reaction for HPV-16 viral load and integration

HPV-16-positive CVL from 75 women were further screened for the presence of inhibitors by real-time PCR. Internal controls for HPV-16 E6 and E2 were synthesized by amplifying the pSP65 plasmid with primers containing pSP65 sequences (20 underlined bases) to which HPV-16 sequences were appended at the 5′ end: ci-16-E6-F [5′–GAGAACTGCAATGTTTCAGGACC

Equation (Uncited)
Equation (Uncited)
Image Tools

–3′, underlined sequences are base pairs (bp) 1–20 from pSP65] and ci-16-E6-R (5′–ATAGTTGTTTGCAGCTCTGTGC

Equation (Uncited)
Equation (Uncited)
Image Tools

–3′ bp 407–426 of pSP65) for the E6 gene and ci-16-E2-F (5′–AACGAAGTATCCTCTCCTGAAATTATTAG

Equation (Uncited)
Equation (Uncited)
Image Tools

–3′ and ci-16-E2-R (5′–CCAAGGCGACGGCTTTG

Equation (Uncited)
Equation (Uncited)
Image Tools

–3′) [25,26]. Amplification of pSP65 with these primers generated pSP65 fragments flanked at both ends by primer sequences used for HPV-16 amplification. One thousand copies of HPV-16 E6, HPV-16 E2 and β-globin internal controls were mixed in separate capillaries with 2 μl CVL lysate and tested in a Light Cycler PCR and detection system (Roche Molecular Systems, haval, Quebec, Canada) with primer pairs described below, as previously published for E6 and β-globin [25,26]. The presence of PCR inhibitors was suspected when the 1000 copy internal control generated a signal corresponding to less than 700 copies for at least one internal control [25,26]. The latter cut-off was established in previous work considering the variability of the assays and the demonstration of inhibition by dilution of lysates [25]. Forty-six samples containing inhibitors [inhibition of both internal controls (n = 4), HPV-16 internal control inhibition only (n = 34) and β-globin internal control inhibition only (n = 8)] were retested with internal controls after dilution of lysate (n = 38) or after DNA purification with Master Pure (n = 8).

Two microlitres of lysate or processed sample without inhibition were then tested in duplicate in separate capillaries for quantitation of HPV-16 E6 and E2 genes, and β-globin DNA using hydrolysis probes as described previously [15]. The 16-E6-PRO probe and primers 16-E6-F and 16-E6-R were utilized for HPV-16 E6 quantitation, whereas HPV-16 E2 gene was quantitated using probe 16-E2-PRO and primers 16-E2-F and 16-E2-R [15]. For both assays, the 20-μl reaction mixture contained 1× DNA Master Hybridization Probe Mix containing the Fast Start Taq DNA polymerase (Roche Molecular Biochemicals), 4 mM magnesium chloride, 0.3 μM of each HPV-16 primer, 50 nM of the fluorogenic probe and 2 μl of processed sample. For β-globin, each sample was amplified in duplicate with 50 nM of β-globin probe U62049, 0.3 μM of primers U61992 and L62240, 4.5 mM magnesium chloride, and 1× DNA Master Hybridization Probe [9,25,26]. Cycling parameters were as described previously [9,25,26].

Cycle thresholds were compared with those of an HPV-16 titration curve obtained by serial 10-fold dilutions of an HPV-16 plasmid, kindly provided by Professor zur Hausen, in a fixed amount of 75 ng human fibroblast DNA in 10 mM Tris-HCl (pH 8.2). Titration curves of human DNA were obtained by serial dilutions of a stock of human genomic DNA (Roche Molecular Biochemicals) in 10 mM Tris-HCl (pH 8.2). HPV-16 E6 and E2 loads were expressed as the number of HPV-16 copies per microgram of human DNA. The integrated HPV-16 viral load was calculated by subtracting the copy numbers of E2 (episomal) from the total copy numbers of E6 (integrated and episomal). Total, episomal and integrated HPV-16 loads were then log-transformed.

Back to Top | Article Outline
Molecular variant analysis by polymerase chain reaction sequencing

HPV-16 isolates were further characterized by PCR sequencing of a 364-bp segment within the long control region (LCR) [27] and of the complete E6 gene [28]. HPV-16 amplicons were generated with 2.5 units of Expand High Fidelity PCR enzyme (Boehringer Mannheim, Laval, Quebec, Canada) and purified with the QIAquick gel extraction kit protocol (Qiagen Inc., Mississauga, Ontario, Canada). Direct double-stranded PCR-sequencing was performed with the fluorescent cycle-sequencing method (BigDye terminator ready reaction kit; Applied Biosystem, Foster City, California, USA) on an ABI Prism 3100 Genetic Analyser system. HPV-16 isolates were classified into two broad categories: prototype and non-prototype strains, and into one of the five lineages as described by Yamada et al. [29].

Back to Top | Article Outline
Statistical analysis

HPV-16 viral loads were measured in specimens collected before biopsy that could alter viral load measurements. Univariate analysis was first performed to identify factors significantly associated with SIL on cytology or with CIN on biopsy, using Fisher's exact test for categorical variables and the Mann–Whitney U test for continuous variables. Analyses of cytology results were conducted by considering the visit for each participant with the highest grade of SIL. Given previous reports on the potential role of the E6 G350T variation in disease [30], it was specifically evaluated in relation to CIN. The magnitude of the association between measures of integrated and episomal HPV-16-DNA load and grade of CIN or SIL was assessed by logistic regression controlling for age, race and a factored variable combining the CD4 cell count and HIV status (HIV negative, HIV positive with CD4 cell counts > 500, 200–500, and < 200 cells/μl). The correlation between the HPV-16 viral load and age or CD4 cell count was measured with the Spearman rank correlation coefficient (ρ). HPV-16 viral loads from isolates of different HPV-16 LCR lineages were compared with the Mann–Whitney U test. All statistical tests were two-sided with statistical significance set at P < 0.05.

Back to Top | Article Outline

Results

The baseline characteristics of the 75 women studied are presented in Table 1. There was no correlation between the total HPV-16 load and age (R = −0.13, P = 0.28) or HPV-16 viral load and CD4 cell count (R = −0.20, P = 0.09). We could not correlate the HPV-16 viral load with the plasma HIV viral load, because several visits had been completed before the advent of HIV viral load testing. When compared two by two, there was a strong correlation between the total, episomal and integrated HPV-16 DNA copies measured in each sample (ρ values from 0.82 to 0.97; P < 0.0001 for each comparison). As shown in Table 2 and Fig. 1 for the 72 participants with cytology smear results, the total, episomal or integrated HPV-16 loads were significantly higher in women with LSIL or HSIL than in women with normal smears (P < 0.02 for each comparison). Similar results were obtained when the first HPV-16-positive visit for each participant was analysed (data not shown). The differences between HPV-16 loads in women with HSIL and LSIL did not reach statistical significance (P > 0.15). There were no differences in age, CD4 cell count, co-infection with types other than 16, HAART, race or HIV status, between women with normal smears, LSIL or HSIL (P > 0.10 for each comparison, data not shown). Controlling for age, race, HIV status and CD4 cell count, a greater quantity of total (OR 1.6, 95% CI 1.1–2.6; P = 0.02), episomal (OR 1.6, 95% CI 1.1–2.5; P = 0.02), and integrated (OR 1.1, 95% CI 1.1–2.0; P = 0.05) HPV-16 DNA was measured in women with HSIL than in women with normal cytology.

Table 1
Table 1
Image Tools
Table 2
Table 2
Image Tools
Equation (Uncited)
Equation (Uncited)
Image Tools
Fig. 1
Fig. 1
Image Tools

As cytology may misclassify cervical disease, we investigated the association between the HPV-16 viral load and cervical disease in 39 women who had undergone colposcopy and biopsy of suspicious lesions and in 24 women who had not undergone colposcopy but had had three consecutive normal smears. The quantities of total, episomal and integrated HPV-16 DNA (Table 3) in CVL from women with high-grade CIN (CIN 2,3) were at least two logs greater than in normal women (P < 0.002). Although CIN 2,3 contained at least 10 times more HPV-16 DNA copies than CIN 1, this difference did not reach statistical significance (P > 0.06). When only HIV-seropositive women were considered, similar results were obtained (Table 3). Southern blot analysis using a 32P-labelled HPV-16 probe was performed on DNA extracted from CVL from three women with a normal cervix and with a load of integrated HPV-16 above the detection threshold of Southern blot, and revealed the presence of integrated forms in all women (data not shown). In previous studies, coefficients of variations of real-time PCR assays for HPV quantitation reached at most 30% [25,26]. E6/E2 ratios greater than two were considered suggestive of integration. E6/E2 ratios greater than two were obtained for 21 out of 35 normal women (60%; including seven with ratios > 4), 11 out of 16 women with CIN 1 (69%) and seven out of 12 women with CIN 2,3 (58%). Excluding one women with CIN 3 who had no HPV-16 DNA detected, the range of HPV-16 integrated loads in five women with CIN 3 (104.20 to 108.46, median of 106.22) was similar to that measured in six women with CIN 2 lesions (0–108.30, median of 105.87). Three out of five women with CIN 3 and four out of six women with CIN 2 had E6/E2 ratios greater than two.

The CD4 cell count was significantly lower in women with CIN 2,3 than in normal women, whereas other factors were not significantly different (Table 4). No isolate carried the 131G variation previously associated with anal SIL [31]. Controlling for HIV status, CD4 cell count and age, total (OR 3.5 95% CI 1.2–10.4; P = 0.02), episomal (OR 2.9 95% CI 1.2–7.4; P = 0.02) and integrated (OR 1.6 95% CI 1.1–2.6; P = 0.05) HPV-16 DNA loads remained significantly associated with CIN 2,3. Similar results were obtained with HIV-infected women only controlling for the CD4 cell count and age (data not shown).

Table 3
Table 3
Image Tools

We then evaluated whether HPV-16 polymorphism could influence HPV-16 viral load measures. The median HPV-16 DNA load in 57 women infected with European variants (median of 105.98, range of 103.67 to 108.88) was higher than in three women infected with Asian LCR variants (median of 103.32, range of 0–105.71; P = 0.04), but similar to nine women infected with African variants (median of 105.08, range of 0–108.48; P = 0.81). A variation at nucleotide 145 in the Asian variant was located in the middle of the probe. Samples with the latter variant were retested with an HPV-16 E6 assay that used primers and probe perfectly homologous with the E6 sequence of non-European variants [32,33]. The mean ratio of HPV-16 E6 load measured with the latter assay and the original assay reached 1.3 ± 0.5. This second HPV-16 E6 assay confirmed the lower total HPV-16 load obtained with the Asian variant (data not shown).

Table 4
Table 4
Image Tools

Finally, as reported by another group [9], the amount of cellular DNA collected per microlitre of processed CVL was greater for women with CIN 2,3 (median 0.052 μg, range 0.030–0.159; P = 0.007) but not CIN 1 (median 0.03 μg, range 0.012–0.063; P = 0.11) than in women with normal cervices (median 0.011 μg, range 0.003–0.026).

Back to Top | Article Outline

Discussion

This study shows that a wide spectrum of episomal, integrated and total HPV-16 DNA loads can be measured with real-time PCR in a population of sexually active women. The measures of episomal and integrated HPV-16 DNA were obtained by a truly quantitative assay that not only normalized the amount of HPV-16 DNA against the quantity of host DNA collected, but also screened for the presence of PCR inhibitors. Our work clearly shows that these two adjustments are mandatory when cell lysates are analysed. As reported previously by two groups [9,34], the cellular content of genital specimens was greater in women with CIN 2,3. HPV-transformed cells may express fewer intercellular adhesion molecules and may be sampled more readily [9]. Several samples contained inhibitors that would have altered our evaluation of HPV-16 or cellular DNA copies. The prospective design of the Canadian Women's HIV study also permitted an analysis of HPV-16 loads considering the highest grade of SIL obtained on consecutive visits. However, our study has limitations. Most women recruited were infected with HIV or were at risk of HIV infection. The small number of participants with lesions did not allow us to test possible associations of age or HPV-16 polymorphism with CIN 2,3, although we did find significant associations between CD4 cells and HPV-16 viral loads with CIN 2,3.

Initial studies using insensitive tools detected integrated forms only in high-grade lesions or cervical cancer [17,35]. As demonstrated here, the presence of integrated forms is difficult to quantitate because of the frequent occurrence of episomal and integrated forms in the same sample [15,36]. More sensitive technologies have demonstrated the presence of integration in precancerous disease [15,18,19,37]. One study demonstrated that nearly half of 92 samples collected from young women with LSIL contained integrated HPV-16 [18], whereas similar results were obtained by another group in another population [19]. Another group reported that nearly all CIN lesions contained integrated forms [15]. Our work is the first extensive report demonstrating integration in normal women. Mixed forms of episomal and integrated HPV-16 can be detected early during infection, before the presence of HPV-induced lesions. Possibly, E2 could still be disrupted without integration, but this possibility has not yet been reported. Some integrated HPV-16 forms may have been missed because only the most frequently disrupted region of E2 was analysed.

The measure of integration with real-time PCR is a novel approach. Differences between E6 and E2 viral loads allowing the measurement of HPV-16 integration may reflect technical limitations of the assays. Real-time PCR assays for HPV quantitation have very good intrarun and interrun reproducibility, with coefficients of variation below 30% [25,38,39]. Similar HPV-16 viral load values are obtained when samples are diluted several fold [25]. In the current study, E6 and E2 were quantitated in duplicate and coefficients of variation were less than 18%, mostly under 10% (data not shown). A high level of concordance was found between HPV-16 loads estimated with HPV-16 E6 and L1 PCR assays (submitted). The slopes of HPV-16 DNA titration curves with the HPV-16 E6 and E2 PCR assays were similar (data not shown), suggesting similar amplification efficiency with the HPV-16 prototype. It is thus unlikely that selective inhibitors to E2 explain the lower HPV-16 E2 viral load results because no inhibition was detected with the internal control for E2 only.

More studies are needed to obtain a better understanding of the meaning of detecting integrated forms in normal women. Although the performance of the E6 and E2 assays were similar, an analysis of the E2 polymorphism to ensure that polymorphic sites at primer or probe binding sites are not responsible for the differences between the E6 and E2 assays would help define the usefulness of these assays. Although the amplification efficiency of the three PCR assays was similar in vitro, they could differ in complex nucleic acid environments.

To date, conflicting results have been obtained from various studies on the association between high HPV viral loads and cervical SIL or CIN [8–13,32,34,40–52]. Although cervical carcinoma in situ has been found in women with consistently high HPV-16 viral loads, HSIL may contain low HPV-16 loads [8,9,45]. Several groups have also demonstrated that HIV-seropositive women with HSIL were infected with greater quantities of HPV DNA [11–14]. We have shown here that high HPV-16 loads are associated with HSIL or CIN 2,3. As reported by others, the important overlap of HPV-16 viral load values between normal women and those with lesions could limit the usefulness of viral load measurements and could partly explain the inconsistencies between studies [12,14]. Moreover, the presence of CIN 1 surrounding CIN 3 lesions can alter HPV viral load estimations and restrict the clinical usefulness of this marker [53]. Eight studies, including our work, have studied the HPV-DNA viral load in exfoliated cervical cells from HIV-infected women [11–14,44,54,55]. Higher HPV viral loads have been measured by some in women with lower CD4 cell counts [12,14]. The lack of correlation between the HPV-16 load and CD4 cells reported here is in line with a recent report [56] demonstrating that prevalent and incident HPV-16 infections were more weakly associated with the immune status than with other HPV types, suggesting that HPV-16 may better avoid immune surveillance. Asian variants were detected at lower viral loads than European isolates, a finding that did not reach statistical significance in a previous report from another cohort [27].

Our findings demonstrate that women who are infected by higher HPV-16 viral loads are more likely to have significant cervical lesions. However, the important overlap between disease grades of HPV-16 viral load does not permit a clear classification of participants. Prospective studies involving a greater number of HPV-16-infected women are needed to define the predictive value of the integrated HPV-16 load versus the total or episomal load for progression. Prospective studies on types other than 16 could also establish whether the same association could be found across high-risk types. No additional information was gained in our study by measuring integrated or episomal over total HPV-16 DNA loads.

Back to Top | Article Outline

Acknowledgements

The authors would like to thank Mme Diane Gaudreault and Mme Diane Bronsard for processing genital samples. They would also like to thank Fabrice Rouah for maintaining the database.

Conflict of interest disclosure: the authors do not have commercial or other associations that might pose a conflict of interest.

Sponsorship: This study was supported by the Canadian Institutes for Health Research and by le Réseau FRSQ Maladies Infectieuses SIDA. The Canadian Institutes for Health Research supports the Canadian Women's HIV Study cohort. F.C. is a national researcher supported by the Fonds de la Recherche en Santé du Québec (FRSQ).

The Canadian Women's HIV Study Group includes the following investigators. Halifax: Janet Conners, Rob Grimshaw, David Haase, Lynn Johnston, Wally Schlech, Arlo Yuzicappi-Fayant. Hamilton: Stephen Landis, Fiona Smaill. London: Tom Austin, Ole Hammerberg, Ted Ralph. Montréal: François Coutlée, Julian Falutz, Alex Ferenczy, Catherine Hankins, Marina Klein, Louise Labrecque, Normand Lapointe, Richard Lalonde, John Macleod, Grégoire Noël, Chantal Perron, Jean-Pierre Routy, Emil Toma. Ottawa: Claire Touchie, Garry Victor. Québec: Louise Coté, Hélène Senay, Sylvie Trottier. Saskatoon: Kurt Williams. Sherbrooke: Alain Piché. Sudbury: Roger Sandre. Toronto: Louise Binder, Donna Keystone, Anne Phillips, Anita Rachlis, Irving Salit, Cheryl Wagner, Sharon Walmsley. Vancouver: Paula Braitstein, David Burdge, Marianne Harris, Deborah Money, Julio Montaner.

All participants provided written informed consent to participate. Ethics committees of each participating institution approved the Canadian Women's HIV Study protocol.

Back to Top | Article Outline

References

1. Jamieson DJ, Duerr A, Burk R, Klein RS, Paramsothy P, Schuman P, et al. Characterization of genital human papillomavirus infection in women who have or who are at risk of having HIV infection. Am J Obstet Gynecol 2002; 186:21–27.

2. Ellerbrock TV, Chiasson MA, Bush TJ, Sun XW, Sawo D, Brudney K, et al. Incidence of cervical squamous intraepithelial lesions in HIV-infected women. JAMA 2000; 283:1031–1037.

3. Moscicki AB, Ellenberg JH, Vermund SH, Holland CA, Darragh T, Crowley-Nowick PA, et al. Prevalence of and risks for cervical human papillomavirus infection and squamous intraepithelial lesions in adolescent girls – impact of infection with human immunodeficiency virus. Arch Pediatr Adolesc Med 2000; 154:127–134.

4. de Sanjose S, Palefsky J. Cervical and anal HPV infections in HIV positive women and men. Virus Res 2002; 89:201–211.

5. Bosch FX, Lorincz A, Munoz N, Meijer CJLM, Shah KV. The causal relation between human papillomavirus and cervical cancer. J Clin Pathol 2002; 55:244–265.

6. Clifford GM, Smith JS, Aguado T, Franceschi S. Comparison of HPV type distribution in high-grade cervical lesions and cervical cancer: a meta-analysis. Br J Cancer 2003; 89:101–105.

7. Sun XW, Kuhn L, Ellerbrock TV, Chiasson MA, Bush TJ, Wright TC Jr. Human papillomavirus infection in women infected with the human immunodeficiency virus. N Engl J Med 1997; 337:1343–1349.

8. Ylitalo N, Sorensen P, Josefsson AM, Magnusson PKE, Anderson PK, Ponten J, et al. Consistent high viral load of human papillomavirus 16 and risk of cervical carcinoma in situ: a nested case–control study. Lancet 2000; 355:2194–2198.

9. Swan DC, Tucker RA, Tortolero-Luna G, Mitchell MF, Wideroff L, Unger ER, et al. Human papillomavirus (HPV) DNA copy number is dependent on grade of cervical disease and HPV type. J Clin Microbiol 1999; 37:1030–1034.

10. Josefsson AM, Magnusson PKE, Ylitalo N, Sorensen P, Qwarforth-Tubbin P, Anderson PK, et al. Viral load of human papilloma virus 16 as a determinant for development of cervical carcinoma in situ: a nested case–control study. Lancet 2000; 355:2189–2193.

11. Womack SD, Chirenje ZM, Gaffikin L, Blumenthal PD, McGrath JA, Chipato T, et al. HPV-based cervical cancer screening in a population at high risk for HIV infection. Int J Cancer 2000; 85:206–210.

12. Lefevre J, Hankins C, Pourreaux K, Coutlée F, and the Canadian Women's HIV study Group. Human papillomavirus type 16 viral load is increased in HIV-seropositive women with high-grade squamous intraepithelial lesions compared to those with normal cytology smears. J Clin Microbiol 2004; 42:2212–2215.

13. Shah KV, Solomon L, Daniel R, Cohn S, Vlahov D. Comparison of PCR and hybrid capture methods for detection of human papillomavirus in injection drug-using women at high risk of human immunodeficiency virus infection. J Clin Microbiol 1997; 35:517–519.

14. Weissenborn SJ, Funke AM, Hellmich M, Mallmann P, Fuschs PG, Pfister HJ, et al. Oncogenic human papillomavirus DNA loads in human immunodeficiency virus-positive women with high-grade cervical lesions are strongly elevated. J Clin Microbiol 2003; 41:2763–2767.

15. Peitsaro P, Johansson B, Syrjanen S. Integrated human papillomavirus type 16 is frequently found in cervical cancer precursors as demonstrated by a novel quantitative real-time PCR technique. J Clin Microbiol 2002; 40:886–891.

16. Hopman AHN, Smedts F, Dignef W, Ummulen M, Sonke G, Mravunac M, et al. Transition to high-grade cervical intraepithelial neoplasia to micro-invasive carcinoma is characterized by integration of HPV16/18 and numerical chromosome abnormalities. J Pathol 2004; 202:23–33.

17. Cullen AP, Reid R, Campion M, Lorincz AT. Analysis of the physical state of different human papillomavirus DNAs in intraepithelial and invasive cervical neoplasms. J Virol 1991; 65:606–612.

18. Gallo G, Bibbo M, Bagella L, Zamparelli A, Sanseverino F, Giovagnoli MR, et al. Study of viral integration of HPV-16 in young patients with LSIL. J Clin Pathol 2003; 56:532–536.

19. Nagao S, Yoshinouchi M, Miyagi Y, Hongo A, Kodama J, Itoh S, et al. Rapid and sensitive detection of physical status of human papillomavirus type 16 DNA by quantitative real-time PCR. J Clin Microbiol 2002; 40:863–867.

20. Hankins C, Coutlee F, Lapointe N, Simard P, Tran T, Samson J, et al. Prevalence of risk factors associated with human papillomavirus infection in women living with HIV. Can Med Assoc J 1999; 160:185–191.

21. Coutlée F, Hankins C, Lapointe N, Gill J, Romanowski B, Shafran S, et al. Comparison betwen vaginal tampon and cervicovaginal lavage specimens collection for detection of human papillomavirus DNA by the polymerase chain reaction. J Med Virol 1997; 51:42–47.

22. Hankins C, Lapointe N, Walmsley S, and the Canadian Women's HIV study Group. Participation in clinical trials among women living with HIV in Canada. Can Med Assoc J 1998; 159:1359–1365.

23. Hildesheim A, Schiffman MH, Gravitt PE, Glass AG, Greer CE, Zhang T, et al. Persistence of type-specific human papillomavirus infection among cytologically normal women. J Infect Dis 1994; 169:235–240.

24. Broder S. The 1991 Bethesda System for reporting cervical/vaginal cytologic diagnoses: report of the 1991 Bethesda Workshop. JAMA 1992; 267:1892.

25. Lefevre J, Hankins C, Pourreaux K, Voyer H, Coutlée F, and the Canadian Women's HIV study Group. Internal controls for quantitation of HPV-16 and β-globin DNA in cervicovaginal lavages. J Virol Methods 2003; 144:135–144.

26. Lefevre J, Hankins C, Pourreaux K, Coutlée F, and the Canadian Women's HIV study Group. Prevalence of selective inhibition of HPV-16 DNA amplification in cervicovaginal lavages. J Med Virol 2004; 72:132–137.

27. Villa LL, Sichero L, Rahal P, Caballero O, Ferenczy A, Rohan T, et al. Molecular variants of human papillomavirus types 16 and 18 preferentially associated with cervical neoplasia. J Gen Virol 2000; 81:2959–2968.

28. van Duin M, Snijders PJF, Vossen MTM, Klaassen E, Voorhorst F, Verheijen RHM, et al. Analysis of human papillomavirus type 16 E6 variants in relation to p53 codon 72 polymorphism genotypes in cervical carcinogenesis. J Gen Virol 2000; 81:317–325.

29. Yamada T, Manos MM, Peto J, Greer CE, Munoz N, Bosch FX, et al. Human papillomavirus type 16 sequence variation in cervical cancers – a worldwide perspective. J Virol 1997; 71:2463–2472.

30. Giannoudis A, Herrington CS. Human papillomavirus variants and squamous neoplasia of the cervix. J Pathol 2001; 193:295–302.

31. Da Costa MM, Hogeboom CJ, Holly EA, Palefsky JM. Increased risk of high-grade anal neoplasia associated with a human papillomavirus type 16 E6 sequence variant. J Infect Dis 2002; 185:1229–1237.

32. Gravitt PE, Burk RD, Lorincz A, Herrero R, Hildesheim A, Sherman ME, et al. A comparison between real-time polymerase chain reaction and hybrid capture 2 for human papillomavirus DNA quantitation. Cancer Epidemiol Biom Prev 2003; 12:477–484.

33. Gravitt PE, Peyton C, Wheeler C, Apple R, Higuchi R, Shah KV. Reproducibility of HPV 16 and HPV 18 viral load quantitation using TaqMan real-time PCR assays. J Virol Methods 2003; 112:23–33.

34. Schlecht NF, Trevisan A, Duarte-Franco E, Rohan TE, Ferenczy A, Villa LL, et al. Viral load as a predictor of the risk of cervical intraepithelial neoplasia. Int J Cancer 2003; 103:519–524.

35. Daniel B, Mukherjee G, Seshadri L, Vallikad E, Krishna S. Changes in the physical state and expression of human papillomavirus type 16 in the progression of cervical intraepithelial neoplasia lesions analysed by PCR. J Gen Virol 1995; 76:2589–2593.

36. Watts KJ, Thompson CH, Cossart YE, Rose BR. Sequence variation and physical state of human papillomavirus type 16 cervical cancer isolates from Australia and New Caledonia. Int J Cancer 2002; 97:868–874.

37. Klaes R, Woerner SM, Ridder R, Wentzensen N, Duerst M, Schneider A, et al. Detection of high-risk cervical intraepithelial neoplasia and cervical cancer by amplification of transcripts derived from integrated papillomavirus oncogenes. Cancer Res 1999; 59:6132–6136.

38. Moberg M, Gustavsson I, Gyllensten U. Real-time PCR-based system for simultaneous quantification of human papillomavirus types associated with high risk of cervical cancer. J Clin Microbiol 2003; 41:3221–3228.

39. Gravitt PE, Peyton C, Wheeler C, Apple R, Higuchi R, Shah KV. Reproducibility of HPV 16 and HPV 18 viral load quantitation using TaqMan real-time PCR assays. J Virol Methods 2003; 112:23–33.

40. Giuliano AR, Papenfuss M, Brown de Gala EM, Feng J, Abrahamsen M, Denman C, et al. Risk factors for squamous intraepithelial lesions (SIL) of the cervix among women residing at the US–Mexico border. Int J Cancer 2004; 109:112–118.

41. Dalstein V, Riethmuller D, Pretet JL, Le Bail C, Sautiere JL, Carbillet JP, et al. Persistence and load of high-risk HPV are predictors for development of high-grade cervical lesions: a longitudinal French cohort study. Int J Cancer 2003; 106:396–403.

42. Clavel C, Masure M, Bory JP, Putaud I, Mangeonjean C, Lorenzato M, et al. Human papillomavirus testing in primary screening for the detection of high-grade cervical lesions: a study of 7932 women. Br J Cancer 2001; 84:1616–1623.

43. van Duin M, Snidjers PJF, Schrijnemakers HFJ, Voorhorst FJ, Rozendaal L, Nobbenhuis MAE, et al. Human papillomavirus 16 load in normal and abnormal cervical scrapes: an indicator of CIN II/III and viral clearance. Int J Cancer 2002; 98:590–595.

44. Klein RS, Ho GYF, Vermund SH, Fleming I, Burk RD. Risk factors for squamous intraepithelial lesions on pap smear in women at risk for human immunodeficiency virus infection. J Infect Dis 1994; 170:404–409.

45. Lorincz AT, Castle PE, Sherman ME, Scott DR, Glass AG, Wacholder S, et al. Viral load of human papillomavirus and risk of CIN3 or cervical cancer. Lancet 2002; 360:228–229.

46. Sherman ME, Schiffman M, Cox JT. Effects of age and human papilloma viral load on colposcopy triage: data from the randomized atypical squamous cells of undetermined significance/low grade squamous intraepithelial lesion triage study (ALTS). J Natl Cancer Inst 2002; 94:102–107.

47. Beskow AH, Gyllensten UB. Host genetic control of HPV 16 titer in carcinoma in situ of the cervix uteri. Int J Cancer 2002; 101:526–531.

48. Sun CA, Liu JF, Wu DM, Nieh S, Yu CP, Chu TY. Viral load of high-risk human papillomavirus in cervical squamous intraepithelial lesions. Int J Gynaecol Obstet 2002; 76:41–47.

49. Cox JT, Lorincz AT, Schiffman MH, Sherman ME, Cullen A, Kurman RJ. Human papillomavirus testing by hybrid capture appears to be useful in triaging women with a cytologic diagnosis of atypical squamous cells of undetermined significance. Am J Obstet Gynecol 1995; 172:946–954.

50. Hall S, Lorincz AT, Shah F, Sherman ME, Abbas F, Paull G, et al. Human papillomavirus DNA detection in cervical specimens by hybrid capture: correlation with cytologic and histologic diagnoses of squamous intraepithelial lesions of the cervix. Gynecol Oncol 1996; 62:353–359.

51. Nindl I, Lorincz A, Mielzynska I, Petry U, Baur S, Kirchmayr R, et al. Human papillomavirus detection in cervical intraepithelial neoplasia by the second generation hybrid capture microplate test, comparing two different cervical specimen collection methods. Clin Diagnost Virol 1998; 10:49–56.

52. Sun CA, Lai HC, Chang CC, Neih S, Yu CP, Chu TY. The significance of human papillomavirus viral load in prediction of histologic severity and size of squamous intraepithelial lesions of uterine cervix. Gynecol Oncol 2001; 83:95–99.

53. Sherman ME, Wang SS, Wheeler CM, Rich L, Gravitt PE, Tarone R, et al. Histopathologic extent of cervical intraepithelial neoplasia 3 lesions in the atypical squamous cells of undetermined significance low-grade squamous intraepithelial lesion triage study: implications for subject safety and lead-time bias. Cancer Epidemiol Biom Prev 2003; 12:1038–1044.

54. Serwadda D, Wawer MJ, Shah KV, Sewankambo NK, Daniel R, Li C, et al. Use of a hybrid capture assay of self-collected vaginal swabs in rural Uganda for detection of human papillomavirus. J Infect Dis 1999; 180:1316–1319.

55. Vernon SD, Reeves WC, Clancy KA, Laga M, St Louis M, Gary HE, et al. A longitudinal study of human papillomavirus DNA detection in human immunodeficiency virus type 1-seropositive and -seronegative women. J Infect Dis 1994; 169:1108–1112.

56. Strickler HD, Palefsky JM, Shah KV, Anastos K, Klein RS, Minkoff H, et al. Human papillomavirus type 16 and immune status in human immunodeficiency virus-seropositive women. J Natl Cancer Inst 2003; 95:1062–1071.

Cited By:

This article has been cited 22 time(s).

Cancer Epidemiology Biomarkers & Prevention
Screening for HIV-Associated Anal Cancer: Correlation of HPV Genotypes, p16, and E6 Transcripts with Anal Pathology
Salit, IE; Tinmouth, J; Chong, S; Raboud, J; Diong, C; Su, DS; Sano, M; Lytwyn, A; Chapman, W; Mahony, J
Cancer Epidemiology Biomarkers & Prevention, 18(7): 1986-1992.
10.1158/1055-9965.EPI-08-1141
CrossRef
Journal of Clinical Virology
Human papillomavirus type 16 (HPV-16) viral load and persistence of HPV-16 infection in women infected or at risk for HIV
Fontaine, J; Hankins, C; Money, D; Rachlis, A; Pourreaux, K; Ferenczy, A; Coutlee, F
Journal of Clinical Virology, 43(3): 307-312.
10.1016/j.jcv.2008.07.013
CrossRef
Journal of Medical Virology
Viral load and genomic integration of HPV 16 in cervical samples from HIV-1-Infected and uninfected women in Burkina Faso
Rousseau, MND; Costes, V; Konate, I; Nagot, N; Foulongne, V; Ouedraogo, A; De Perre, PV; Mayaud, P; Segondy, M
Journal of Medical Virology, 79(6): 766-770.
10.1002/jmv.20888
CrossRef
Modern Pathology
Distribution and viral load of eight oncogenic types of human papillomavirus (HPV) and HPV 16 integration status in cervical intraepithelial neoplasia and carcinoma
Guo, M; Sneige, N; Silva, EG; Jan, YJ; Cogdell, DE; Lin, E; Luthra, R; Zhang, W
Modern Pathology, 20(2): 256-266.
10.1038/modpathol.3800737
CrossRef
Vaccine
New Technologies in Cervical Cancer Screening
Gravitt, PE; Coutlee, F; Iftner, T; Sellors, JW; Quint, WGV; Wheeler, CM
Vaccine, 26(): K42-K52.
10.1016/j.vaccine.2008.05.002
CrossRef
Cancer Epidemiology Biomarkers & Prevention
Human Papillomavirus 16 Load and E2/E6 Ratio in HPV16-Positive Women: Biomarkers for Cervical Intraepithelial Neoplasia >= 2 in a Liquid-Based Cytology Setting?
Boulet, GAV; Benoy, IH; Depuydt, CE; Horvath, CAJ; Aerts, M; Hens, N; Vereecken, AJ; Bogers, JJ
Cancer Epidemiology Biomarkers & Prevention, 18(): 2992-2999.
10.1158/1055-9965.EPI-09-0025
CrossRef
International Journal of Cancer
Viral load of episomal and integrated forms of human papillomavirus type 33 in high-grade squamous intraepithelial lesions of the uterine cervix
Khouadri, S; Villa, LL; Gagnon, S; Koushik, A; Richardson, H; Matlashewski, G; Roger, M; Ferenezy, AS; Franco, EL; Coutlee, F
International Journal of Cancer, 121(): 2674-2681.
10.1002/ijc.23006
CrossRef
Clinical Biochemistry
The performance of the HPV16 real-time PCR integration assay
Ruutu, MP; Kulmala, SM; Peitsaro, P; Syrjanen, SM
Clinical Biochemistry, 41(6): 423-428.
10.1016/j.clinbiochem.2007.12.014
CrossRef
Cancer Epidemiology Biomarkers & Prevention
Human Papillomavirus Types 16 and 18 DNA Load in Relation to Coexistence of Other Types, Particularly Those in the Same Species
Xi, LF; Edelstein, ZR; Meyers, C; Ho, J; Cherne, SL; Schiffman, M
Cancer Epidemiology Biomarkers & Prevention, 18(9): 2507-2512.
10.1158/1055-9965.EPI-09-0482
CrossRef
Journal of Clinical Microbiology
Evaluation of a commercialized in situ hybridization assay for detecting human papillomavirus DNA in tissue specimens from patients with cervical Intraepithelial neoplasia and cervical carcinoma
Guo, M; Gong, Y; Deavers, M; Silva, EG; Jan, YJ; Cogdell, DE; Luthra, R; Lin, E; Lai, HC; Zhang, W; Sneigel, N
Journal of Clinical Microbiology, 46(1): 274-280.
10.1128/JCM.01299-07
CrossRef
Clinical Microbiology and Infection
New molecular method for the detection of human papillomavirus type 16 integration
Canadas, MP; Darwich, L; Sirera, G; Cirigliano, V; Bofill, M; Clotet, B; Videla, S
Clinical Microbiology and Infection, 16(7): 836-842.
10.1111/j.1469-0691.2009.02964.x
CrossRef
Antiviral Research
Conditionally replicating lentiviral-hybrid episomal vectors for suicide gene therapy
Vargas, J; Klotman, ME; Cara, A
Antiviral Research, 80(3): 288-294.
10.1016/j.antiviral.2008.06.015
CrossRef
Nature Protocols
A universal real-time PCR assay for the quantification of group-M HIV-1 proviral load
Malnati, MS; Scarlatti, G; Gatto, F; Salvatori, F; Cassina, G; Rutigliano, T; Volpi, R; Lusso, P
Nature Protocols, 3(7): 1240-1248.
10.1038/nprot.2008.108
CrossRef
Gynecologic Oncology
p16(INK4A) in routine practice as a marker of cervical epithelial neoplasia
Kurshumliu, F; Thorns, C; Gashi-Luci, L
Gynecologic Oncology, 115(1): 127-131.
10.1016/j.ygyno.2009.06.020
CrossRef
Cancer Epidemiology Biomarkers & Prevention
High level of correlation of human papillomavirus-16 DNA viral load estimates generated by three real-time PCR assays applied on genital specimens
Fontaine, J; Gravitt, P; Duh, LM; Lefevre, J; Pourreaux, K; Hankins, C; Coutlee, F
Cancer Epidemiology Biomarkers & Prevention, 14(9): 2200-2207.
10.1158/1055-9965.EPI-05-0055
CrossRef
Journal of Clinical Microbiology
Human papillomavirus type 16 integration in cervical carcinoma in situ and in invasive cervical cancer
Arias-Pulido, H; Peyton, CL; Joste, NE; Vargas, H; Wheeler, CM
Journal of Clinical Microbiology, 44(5): 1755-1762.
10.1128/JCM.44.5.1755-1762.2006
CrossRef
Journal of General Virology
Influence of human papillomavirus type 16 (HPV-16) E2 polymorphism on quantification of HPV-16 episomal and integrated DNA in cervicovaginal lavages from women with cervical intraepithelial neoplasia
Azizi, N; Brazete, J; Hankins, C; Money, D; Fontaine, J; Koushik, A; Rachlis, A; Pourreaux, K; Ferenczy, A; Franco, E; Coutlee, F
Journal of General Virology, 89(): 1716-1728.
10.1099/vir.0.83579-0
CrossRef
Journal of Medical Virology
Polymorphism of the Capsid L1 Gene of Human Papillomavirus Types 31, 33, and 35
Cornut, G; Gagnon, S; Hankins, C; Money, D; Pourreaux, K; Franco, EL; Coutlee, F
Journal of Medical Virology, 82(7): 1168-1178.
10.1002/jmv.21777
CrossRef
Journal of Antimicrobial Chemotherapy
Human papillomavirus viral load: a possible marker for cervical disease in HIV-infected women
Lillo, FB; Uberti-Foppa, C
Journal of Antimicrobial Chemotherapy, 57(5): 810-814.
10.1093/jac/dkl073
CrossRef
Medicinski Glasnik
Diagnostic methods and techniques in cervical cancer prevention Part II: Molecular diagnostics of HPV infection
Vince, A; Lepej, SZ
Medicinski Glasnik, 7(1): 18-25.

Clinical Microbiology and Infection
Markers of human papillomavirus infection and their correlation with cervical dysplasia in human immunodeficiency virus-positive women
Riva, E; Serraino, D; Pierangeli, A; Bambacioni, F; Zaniratti, S; Minosse, C; Selleri, M; Bucci, M; Scagnolari, C; Degener, AM; Capobianchi, MR; Antonelli, G; Dianzani, F
Clinical Microbiology and Infection, 13(1): 94-97.
10.1111/j.1469-0691.2006.01568.x
CrossRef
Cancer Epidemiology Biomarkers & Prevention
Prospective Study of HPV16 Viral Load and Risk of In Situ and Invasive Squamous Cervical Cancer
Sundstrom, K; Ploner, A; Dahlstrom, LA; Palmgren, J; Dillner, J; Adami, HO; Ylitalo, N; Sparen, P
Cancer Epidemiology Biomarkers & Prevention, 22(1): 150-158.
10.1158/1055-9965.EPI-12-0953-T
CrossRef
Back to Top | Article Outline
Keywords:

HPV; CIN; ASCUS; viral load; integration

© 2005 Lippincott Williams & Wilkins, Inc.

Login

Search for Similar Articles
You may search for similar articles that contain these same keywords or you may modify the keyword list to augment your search.