Skip Navigation LinksHome > January 3, 2005 - Volume 19 - Issue 1 > Improvements in lipoatrophy, mitochondrial DNA levels and fa...
AIDS:
Basic Science

Improvements in lipoatrophy, mitochondrial DNA levels and fat apoptosis after replacing stavudine with abacavir or zidovudine

McComsey, Grace Aa,b; Paulsen, Denise Mc; Lonergan, J Tylerd; Hessenthaler, Siegrid Mc; Hoppel, Charles Lb; Williams, Vanessa Cc; Fisher, Robin Lc; Cherry, Catherine Le; White-Owen, Cathyb; Thompson, Katherine Ae; Ross, Steve Tc; Hernandez, Jaime Ec; Ross, Lisa Lc

Free Access
Article Outline
Collapse Box

Author Information

aRainbow Babies and Children's Hospital

bCase School of Medicine Center for AIDS Research, Cleveland, Ohio

cGlaxoSmithKline

dUniversity of California, San Diego, California, USA

eMonash University and the Burnet Institute, Melbourne, Australia

Received 29 January, 2004

Revised 9 June, 2004

Accepted 7 September, 2004

Sponsorship: Supported by GlaxoSmithKline. ABC and ZDV were supplied by GlaxoSmithKline. G. McComsey received grant support, is a consultant and serves on the Speaker Bureau for GlaxoSmithKline, Bristol-Myers Squibb, Agouron/Pfizer and Merck Sharp & Dohme. J. T. Lonergan is a consultant for GlaxoSmithKline, Gilead Sciences and Abbott Laboratories. D. M. Paulsen, V. C. Williams, R. L. Fisher, S. T. Ross, S. M. Hessenthaler, J. E. Hernandez and L. L. Ross are/were employees of GlaxoSmithKline during the conduct of the study.

Correspondence to G. McComsey, 11100 Euclid Avenue, mailstop 8A, Cleveland, Ohio 44106, USA. E-mail: mccomsey.grace@clevelandactu.org

Collapse Box

Abstract

Objective: To determine if stavudine (α4T)-associated mitochondrial toxicity could be reversed by substitution with another nucleoside reverse transcriptase inhibitor. As apoptosis and dysfunction of electron transport chain (ETC) activities may underlie mitochondrial toxicity, these parameters were also evaluated.

Design: The 16 participants (on d4T for >3 years; with lipoatrophy and/or hyperlactatemia) substituted abacavir or zidovudine for stavudine in their antiretroviral regimen. Key parameters including dual-energy X-ray absorptiometry (DEXA) scans, fat apoptosis, mitochondrial DNA (mtDNA) content in peripheral blood mononuclear cells (PBMC), skeletal muscle and fat, as well as skeletal muscle mitochondrial ETC activities were evaluated at study entry and at 48 weeks after the substitution.

Methods: Quantitative PCR was used to evaluate mtDNA levels and the presence of deletions/rearrangements; CLIA-validated methods for ETC activities; terminal deoxynucleotidyl transferase dUTP-digoxigenin nick-end labeling assays to evaluate adipocyte apoptosis; and DEXA scans to measure changes in body fat.

Results: MtDNA was depleted at study entry in muscle, adipose tissue and PBMC but levels rebounded with respective mean increases of 141%, 146%, and 369% at week 48. Corresponding fat improvements were noted with DEXA increases of 21%, 11%, and 16% in arm, leg, and trunk, respectively. Quantitative adipocyte apoptosis were significantly increased at baseline (P < 0.01 versus HIV-negative controls), with a significant reduction at week 48 (P < 0.05 versus baseline). Mean values for seven mitochondrial enzyme activities assays at entry indicated substantial loss of function (48% to 85% of controls) with significant improvement of complex I activity by week 48.

Conclusions: Substitution of stavudine with abacavir or zidovudine improves mitochondrial indices and fat apoptosis in the setting of lipoatrophy.

Back to Top | Article Outline

Introduction

Nucleoside reverse transcriptase inhibitors (NRTI) have been shown to cause mitochondrial dysfunction in vitro [1,2] and several clinical toxicities including lactic acidosis, hepatic steatosis, peripheral neuropathy, and myopathy which have been linked to mitochondrial dysfunction [3]. Recent studies have suggested that NRTI-related mitochondrial dysfunction plays a major role in lipoatrophy [4–6] and have identified stavudine (d4T) as a particular risk factor [7,8]. Indeed, d4T has been shown to induce a higher degree of mitochondiral (mt)DNA depletion than other NRTI, such as zidovudine (ZDV) and abacavir (ABC) [9,10]. In addition to mtDNA depletion, studies have found mtDNA deletions, functional mitochondrial abnormalities and fat apoptosis in subjects with lipoatrophy [4,6,11]. It has been suggested that fat apoptosis in lipoatrophy could be linked to cytokine dysregulation [12].

We and others [13–15] have shown that subcutaneous lipoatrophy improves after substitution of d4T for ABC or ZDV. We designed this present study to assess the reversibility of abnormal mitochondrial indices in a group of 16 HIV-infected patients who had been on d4T for over 3 years and who had lipoatrophy and/or hyperlactatemia. Fat apoptosis, mtDNA content in peripheral blood mononuclear cells (PBMC), skeletal muscle and fat, muscle mitochondrial electron transport chain (ETC) activities and cytokine expression in adipose tissue were evaluated at study entry and 48 weeks after substitution of d4T with ABC or ZDV.

Back to Top | Article Outline

Materials and methods

Subjects in this study were a subgroup of the GlaxoSmithKline-sponsored ESS40010 (TARHEEL) study that enrolled 118 HIV-infected subjects with lipoatrophy and/or hyperlactatemia who had been on d4T for at least 6 months [14]. Participation in the substudy was based on the ability to perform biopsies at the sites and the subjects’ willingness to participate. Substudy sites included Case Western Reserve University, Cleveland, Ohio (n = 10), UCSD Antiviral Research Center in San Diego, California (n = 4), Boriken Neighborhood Health Center, New York, (n = 1), and Bronx VA Medical Center, New York, (n = 1). Local investigators were given the option to substitute either ABC or ZDV for d4T, and all but two subjects were switched to ABC. Adipose and muscle tissues were obtained from HIV-1 negative donors (ZEN-BIO, inc., Ardais, ABS) who were otherwise undergoing elective cosmetic surgery. PBMC were also obtained from HIV-1 negative donors at both Case Western Reserve and GlaxoSmithKline. No attempt was made to match age groups for PBMC in the HIV negative volunteers.

Measurements of all indices were taken at baseline (study entry) during therapy with d4T, and at 48 weeks after substitution of d4T with ABC or ZDV. Informed consent was obtained from patients according to the human experimentation guidelines of the US Department of Health and Human Services and those of the participating institutions.

Back to Top | Article Outline
Tissue sampling and DNA extraction

Each subject underwent fat and muscle biopsies at study entry and had 10 ml of venous blood extracted for PBMC isolation. Twelve subjects underwent repeat sampling at week 48 of the study. One subject refused biopsies but did have PBMC mtDNA performed, and three discontinued prematurely from the study. The biopsies were done in the operating room under heavy sedation with local anesthetic injected only above the fascia, so not to impair ETC activities. The protocol called for the incision to be made in the lateral thigh and the vastus lateralis muscle to be sampled. Subcutaneous fat was removed during the same surgical procedure. All tissue samples were stored at −80 °C and not thawed prior to analysis, at which time the tissue was carefully dissected to remove any visible extraneous non-fat tissue. DNA was extracted from PBMC and biopsies of adipose and muscle tissue at baseline and at 48 weeks for mtDNA analysis. As controls, the same tissue types were also analyzed for mtDNA levels in HIV-uninfected donors in the same age range. PBMC were isolated from whole blood using lymphocyte separation media (LSM, ICN/Cappel, Aurora, Ohio, USA). Cells were then washed three times in D-PBS at room temperature and centrifuged at 260 g for 15 min, depleting platelets by 20% prior to extraction. Total DNA was extracted from approximately 25 mg of tissue or from PBMC isolated from 2 ml whole blood using the QIAamp DNA Mini Kit (Qiagen Inc. California, USA).

Back to Top | Article Outline
Assessment of changes in body fat

Changes in physical signs of lipoatrophy were assessed by full-body dual-energy X-ray absorptiometry (DEXA) (Hologic QDR-4500A, Hologic, Inc., Waltham, Massachusetts, USA) at baseline and week 48. At the same time points, assessments of weight and body mass index were performed.

Back to Top | Article Outline
Mitochondrial DNA quantification

Quantitative PCR was performed on serial dilutions (1 to 1:100) of total DNA from PBMC, adipose and muscle tissue. MtDNA and genomic DNA from experimental samples were assayed by real-time PCR using an ABI7900 analyzer (Applied Biosystems Inc., California, USA) and the results compared against standard curves generated using plasmid controls for both mtDNA and nuclear genes. The number of mtDNA genomes was calculated per nuclear genome and converted to mitochondrial copies per cell for fat and PBMC, and per genomic equivalent for muscle, which is multi-nucleated [16].

Back to Top | Article Outline
Assay for large deletions or rearrangements

Analysis for the presence of large rearrangements and deletions was performed by amplifying a 120-bp area of the 16S rRNA gene and a 225-bp area in a region included in all three of the major mtDNA deletions. Two primer probe sets: GWmt18F (AAAAGTAAAAGGAACTCGGCAAA) / GWmt19R (AGGGTACCGCGGCCGT) / GWmt20P (FAM-AGCATCACCAGTATTAGAGGCACCGC-QSY) and GWmt10F (CCTGTAGCATTGTTCGTTACATGG) / GWmt11R (TGTTGGCATCTGCTCGGG) / GW14P (FAM-TCATCGGCTGAGAGGGCGTAGGA-QSY) were used. Samples were run in triplicate on an ABI 7900 and ratios of the resulting counts were compared to that of pooled putative normal donors. These results were confirmed using long extension PCR in separate PCR reactions using three different mitochondrial primers sets which would result in PCR products of 6.5, 10.4 and 14.3 kb, respectively if no rearrangements were present, and 3.9 kb if rearrangements were present.

Back to Top | Article Outline
Adipocyte apoptosis assays

The degree of subcutaneous adipocyte apoptosis was assessed by terminal deoxynucleotidyl transferase dUTP-digoxigenin nick-end labeling (TUNEL) of fixed sections of fat from study subjects and HIV-uninfected controls. Histology was assessed by a pathologist blinded to date of specimen collection, as well as to clinical and treatment details. The degree of apoptosis was graded from 0 (no TUNEL-positive cells) to 3 (most adipocytes TUNEL positive). Duplicate slide scores were averaged. In addition, quantitative analysis of apoptotic adipocytes per unit area of adipose tissue was performed using video image analysis by a blinded histologist.

Back to Top | Article Outline
Mitochondrial ETC activities

All tissue samples were stored at −80 °C. Frozen skeletal muscle samples were thawed immediately prior to analysis and homogenates prepared using cholate. ETC activities were measured using CLIA validated methods and were performed at the CIDEM laboratory (Case Western Reserve University, Cleveland, Ohio) which has a wide experience of more than a decade in performance of ETC and other mitochondrial assays [17–20].

Measurements of NADH cytochrome c reductase (NCR) reflecting activities of complex I and III, NADH ferricyanide reductase (first three subunits of complex I), succinate cytochrome c reductase (complex II and III), succinate dehydrogenase, decylubiquinol cytochrome c reductase (complex III), cytochrome c oxidase (complex IV), and citrate synthase (marker of mitochondrial mass) were performed. In our laboratory, ETC activities determined by using frozen skeletal muscle were equivalent to those using fresh tissues (C. Hoppel, personal communication)

Back to Top | Article Outline
Cytokine expression levels in fat tissues

Levels of interleukin (IL)-1 (α and β), IL-2, IL-4, IL-5, IL8, IL-10, IL-12 (p35 and p40), IL-15, interferon-γ and tumor necrosis factor (TNF)-α RNA expression were measured at baseline and week 48. Total RNA was extracted from 25 mg of adipose tissue using the RNeasy Mini Kit (Qiagen) and DNA removed using on-column DNase digestion with the RNase-Free DNase Set (Qiagen). cDNA was generated from 2 μg RNA from subject samples and a normal control provided using the High-Capacity cDNA Archive Kit (Applied Biosystems). Five-hundred nanograms cDNA was used in each reaction well of the TaqMan Cytokine Gene Expression Plate I (Applied Biosystems). Samples were done in duplicate for each of the 12 cytokines and a normal human cDNA calibrator was used in each plate. Real-time PCR was performed on the ABI 7900 and results analyzed on the Sequence Detection Software v1.7.

Back to Top | Article Outline
Statistical analysis

The Wilcoxon signed-rank test was used to test whether the change from baseline to week 48 was different from zero for the adipose tissue, muscle, and PBMC data. The 95% confidence intervals (CI) were calculated for the mean mtDNA levels using the normal approximation. Interquartile ranges were also calculated for the mtDNA and apoptosis results. These analyses were not adjusted for multiple comparisons due to the small sample size and the descriptive nature of the analyses.

Back to Top | Article Outline

Results

Sixteen subjects participated in the substudy, and 12 underwent repeat tissue sampling at week 48. An additional subject had PBMC analyzed at week 48. Demographics for the substudy subjects are presented in Table 1 along with the 118 subjects who participated in the main study. At entry, 15/16 (95%) were on a protease inhibitor (PI) and 7/16 (44%) were on a non-nucleoside reverse transcriptase inhibitor. Antiretroviral therapy was maintained throughout the 48 weeks of the study in all subjects. All 16 substudy subjects and 97% (114/117) of the main study participants had lipoatrophy. Substudy subjects were comparable to those in main study with no notable selection bias. All 16 substudy subjects had been on d4T for at least 3 years, and seven of them had hyperlactatemia, with at least one symptom suggestive of mitochondrial toxicity. Undetectable HIV-2 RNA levels were maintained throughout the study with median levels of 1.69 log10 copies/ml for at study entry and week 48.

Table 1
Table 1
Image Tools

No subject developed serious adverse events as a result of the procedures. Most subjects developed self-limited pain at the site of the incisions. Six subjects developed small painless seromas at the site of the incision; uncomplicated needle aspiration was required in one subject.

Results of serial DEXA scans are shown in Fig. 1. Median increases from baseline in arm, leg, trunk, and total limb adipose mass of 21%, 11%, 16%, and 15%, respectively were seen at week 48 (arm P = 0.101; leg P = 0.101; trunk P = 0.006; limb fat P = 0.068) from baseline. At week 48, weight, body mass index, fasting lipids and pyruvate were not significantly different from baseline. Lactate levels significantly decreased (change from baseline −0.40; P = 0.012).

Fig. 1
Fig. 1
Image Tools

MtDNA levels were determined in fat, muscle and PBMC at study entry week 0 (n = 16) and at week 48 (n = 12). The fat specimen of one of the 12 subjects who underwent repeat biopsies at week 48 was lost. The control samples included PBMC (n = 30), muscle (n = 13), and adipose tissue (n = 25) from HIV-uninfected donors. Tissue samples of fat and muscle from uninfected donors were in the same age range ± 5 years as the 16 patients. As seen in Fig. 2a, the mean patient (n = 16) week 0 mtDNA/cell in PBMC was 64, but rose by week 48 to 256 (n = 13, P < 0.0001). The mean PBMC mtDNA/cell was 448 in HIV-negative controls. There is no overlap between the week 0 and week 48 PBMC 95% CI, or between the HIV-negative control mtDNA and the week 0 patient mtDNA confidence intervals.

Fig. 2
Fig. 2
Image Tools

As seen in Fig. 2b, mean muscle mtDNA/cell was 2305 at week 0 (n = 16), and rose to 3754 at week 48 (n = 12, P = 0.11 versus week 0). The mean muscle mtDNA/nuclei was 3927 for the HIV-negative donors. 95% CI are shown with the mean value.

Comparable results for adipose tissue are shown in Fig. 2c. The mean week 0 mtDNA/adipose tissue cell ratio was 194 (n = 16), and rose at week 48 to 430 mtDNA/cell (n = 11, P = 0.01 versus week 0). The mean mtDNA/adipose tissue cell was 921 copies/cell for the HIV-negative controls. 95% CI are shown with each mean value in Fig. 2, and do not overlap.

We conducted an analysis to determine the correlations between mtDNA levels in the three compartments examined (muscle, fat and PBMC) at baseline and week 48 as well as changes in levels on-study. The strongest correlations found were between mtDNA in fat and mtDNA in PBMC at baseline (correlation coefficient, 0.718; P = 0.0017), between change from baseline in mtDNA in muscle and change from baseline in mtDNA in PBMC (correlation coefficient, −0.664; P = 0.0185), and between change from baseline in mtDNA in fat and change from baseline in mtDNA in muscle (correlation coefficient, −0.600; P = 0.05). The correlation coefficient between change from baseline in mtDNA (adipose tissue) and mtDNA (PBMC) was 0.218; P = 0.519.

No large mitochondrial genomic deletions or rearrangements were detected for study subjects or controls.

The results of the TUNEL assay are summarized in Fig. 3. Enough adipose tissues for apoptosis assays were available from 13 subjects at week 0, 10 at week 48, and 20 uninfected controls. The analysis of three additional week 0 samples and two week 48 samples were inconclusive due to minimal numbers of adipocytes present in the fixed sections. Few apoptotic adipocytes were seen in samples from HIV uninfected controls (median score 0.5, n = 20). Tissue from subjects on d4T with lipoatrophy was found to have many apoptotic cells (median score 2, n = 13.) and this appeared to reduce following cessation of stavudine, with a median apoptosis score of 1.25 in fat biopsies collected 48 weeks after switching stavudine to another NRTI.

Fig. 3
Fig. 3
Image Tools

The results of all skeletal muscle ETC activities are summarized in Table 2. At study entry, mitochondrial dysfunction was evident; mean baseline values for ETC activities (complex I–IV) ranged from 48% to 85% of the mean levels observed in controls. The most consistent alterations were noted with complexes I and III. Depressed citrate synthesis was also observed reflecting a quantitative loss of mitochondrial mass. Significant respiratory chain dysfunction was noted in 7/16 subjects at week 0, and 3 had very marked deficiencies in at least two enzyme assays. Results of the enzyme activities are shown as mean ± SD; the unit is nmol/min/g wet weight. As seen in Fig. 4, there was significant improvement in NCR at week 48 which reflects activity of complex I and III, from 0.6 ± 0.5 at baseline to 0.9 ± 0.6 at week 48; P = 0.020). In contrast, significant worsening in complex III activity was seen; 6.0 ± 3.9 at week 48 versus 12.3 ± 5.5 at baseline; P = 0.027. Other changes in enzyme activities were not significant. These results were similar when analyzed using absolute values, or relative values after normalization for citrate synthase, which adjusts for mitochondrial number.

Table 2
Table 2
Image Tools
Fig. 4
Fig. 4
Image Tools

Immunologic assessments included CD4 cell counts and measurements of adipose tissue levels of 12 cytokine mRNAs. All of these indices remained unchanged compared to week 0 (data not shown).

Back to Top | Article Outline

Discussion

While several studies have shown that in the setting of lipoatrophy, the substitution of abacavir or ZDV for d4T improve subcutaneous fat content [13–15] the potential for reversibility of abnormal mitochondrial indices and fat apoptosis after such interventions has not been previously investigated. In our study, we chose to switch from d4T to ABC or ZDV because several studies have shown that d4T has a more deleterious effect on mitochondria than either ABC or ZDV [1,21]. ZDV was permitted for those patients who elected not to take ABC. Since only two of the 16 patients switched to ZDV, the results for these two patients were not analyzed separately; however, they did not differ noticeable from those of subjects who switched to ABC (data not shown).

In this study, we showed a depletion of mtDNA content and alteration of mitochondrial function in d4T-treated patients with lipoatrophy, and a partial reversion after substitution of d4T with ABC or ZDV for 48 weeks. Unfortunately, only two subjects switched d4T to ZDV, precluding us from making any separate observation regarding the d4T to ZDV switch intervention. In the main TARHEEL study, we had shown that d4T switch to ZDV led to improvement of subcutaneous fat, although not to the level seen with d4T to ABC switch [14].

Due to its non-invasive nature, mtDNA content in blood fractions has been investigated in several studies as a marker of mitochondrial toxicity with conflicting results [22–25]. In our study, the findings of mtDNA depletion at baseline are consistent with prior studies which found mtDNA depletion in blood and/or fat [4,26,27]. The current study evaluated three tissue types (muscle, adipose tissue, and PBMC) concurrently from each patient to provide a more global assessment of the effect of NRTI on mitochondria and to determine if there is tissue specificity in mitochondrial dysfunction or recovery. In addition, functional assessment of mitochondria is not standardized in blood or fat, and therefore sampling of muscle was necessary. Substantial mean increases in the levels of mtDNA (141, 146, and 369%) from baseline were observed at week 48 in muscle, adipose tissue, and PBMC, respectively. These levels were consistent with previously published data on adipose tissue of patients with lipoatrophy [4,26]. The respective percent of the HIV negative control values were 96%, 47%, and 57% at week 48. Interestingly, we did find a significant correlation between on-study changes in muscle mtDNA and on-study changes in both PBMC and fat mtDNA, the latter two being easier compartments to access in clinical practice.

Consistent with prior studies [4,25], we found no large deletions or rearrangements of the mitochondrial genome at baseline or week 48 for any of the patients or controls.

While the minimum mtDNA content (threshold level) for normal function has not been established, the substantial increases seen in this study indicate considerable recovery and also point to the marked level of depletion after 3 years on d4T-containing antiretroviral therapy. In inherited mitochondrial diseases, severe symptoms usually occur when mtDNA are depleted to approximately 20% of normal, although this threshold seems to depend on the tissue examined [28]. This threshold has not been yet established in fat tissues.

There has been one previous study examining muscle ETC activities in HIV-infected patients and deficiencies were noted [6]. Our study was consistent in revealing similar deficiencies at study entry. Surprisingly, 48 weeks following the NRTI switch, only the activity of complex I improved. While the mitochondrial compensatory mechanisms are robust, these patients may have reached levels of depletion that could not be compensated. Alternatively, reversal of mitochondrial dysfunction may take longer than 48 weeks to occur. Lastly, as had been previously suggested [25,29], mtDNA depletion may not be the sole mechanism involved in the NRTI-induced mitochondrial dysfunction.

Another intriguing finding is the lack of correlation between changes in muscle mtDNA and citrate synthase activity, the latter being widely used as an indirect measure of mitochondrial mass [30–32]. Despite improvement in mtDNA, citrate synthase remained unchanged. This enzyme is coded in the nucleus, produced in the cytoplasm, and then incorporated into the mitochondria. Therefore, it is conceivable that the defect in NRTI-associated mitochondrial dysfunction could be linked at least partly to a defect in nuclear DNA.

Increases in mitochondrial content were associated with increases in arm, leg, and trunk adipose tissue of 21%, 11%, and 16%, respectively. This suggests that the recovery of mitochondrial content may be a factor in the reversal of lipoatrophy. Moyle had suggested that the significant increase in limb fat seen in his study after d4T substitution to ABC may be linked to the observed decrease in CD4 cells [15]. Our study suggests otherwise, since the improvement in fat was not associated with either changes in CD4, HIV RNA, nor with changes in fat levels of 12 measured cytokine mRNAs. This suggests that the improvement seen in fat more probably reflects the consequence of improved mitochondria, rather than the effect of immune reconstitution.

Recent studies suggested apoptosis, rather than necrosis to be the primary mechanism involved in lipoatrophy [11,33]. In this study, increased levels of adipocyte apoptosis along with decreased mtDNA were noted in adipose tissue from d4T-treated subjects with lipoatrophy relative to uninfected controls. We showed that 48 weeks after substituting ABC or ZDV for d4T, fat apoptosis was reduced to levels seen in HIV-negative controls and fat mtDNA was significantly increased along with improvement in DEXA measured regional body fat. These findings suggest that adipocyte apoptosis secondary to mitochondrial toxicity may be an underlying mechanism for lipoatrophy, and that this toxicity is reversible after switching patients from d4T to ABC or ZDV. Domingo found no changes in fat apoptosis in subjects who switched the PI to nevirapine [34]. Our study is the first to show improvement of fat apoptosis after an intervention for lipoatrophy, and suggest that the increased apoptosis observed in lipoatrophy is due to the NRTI component.

There are a number of limitations to this study, including the small number of subjects and the uncontrolled design. It is important to recognize the major feasibility issues that one encounters when trying to conduct controlled studies that involve such invasive procedures.

In conclusion, the observations in this d4T-treated cohort of patients with evidence of lipoatrophy and/or hyperlactatemia suggest that it is possible to at least partially reverse the mitochondrial dysfunction and fat loss associated with d4T use by substitution with ABC or ZDV. Larger and longer studies are needed to elucidate the mechanisms involved in both the initial depletion and recovery of mitochondrial function.

Back to Top | Article Outline

Acknowledgements

The authors thank the other study investigators, Drs Milano and Brown, and Michael Dube for his critical review of the manuscript, Steve Wesselingh for technical advice and support, and the following GSK personnel: Tracey Lancaster, Carol Humphries, Ilise Minto, and Brian Wine.

Back to Top | Article Outline

References

1. Chen CH, Vazquez-Padua M, Cheng YC. Effect of anti-human immunodeficiency virus nucleoside analogs on mitochondrial DNA and its implication for delayed toxicity. Mol Pharmacol 1991; 39:625–628.

2. Lewis W, Dalakas MC. Mitochondrial toxicity of antiviral drugs. Nat Med 1995; 1:417–422.

3. Brinkman K, ter Hofstede HJ, Burger DM, Smeitink JA, Koopmans PP. Adverse effects of reverse transcriptase inhibitors: mitochondrial toxicity as common pathway. AIDS 1998; 12:1735–1744.

4. Walker UA, Bickel M, Lutke Volksbeck SI, Ketelsen UP, Schofer H, et al. Evidence of nucleoside analogue reverse transcriptase inhibitor–associated genetic and structural defects of mitochondria in adipose tissue of HIV-infected patients. J Acquir Immune Defic Syndr 2002; 29:117–121.

5. Brinkman K, Smeitink JA, Romijn JA, Reiss P. Mitochondrial toxicity induced by nucleoside-analogue reverse-transcriptase inhibitors is a key factor in the pathogenesis of antiretroviral-therapy-related lipodystrophy. Lancet 1999; 354:1112–1115.

6. Zaera MG, Miro O, Pedrol E, Soler A, Picon M, Cardellach F, et al. Mitochondrial involvement in antiretroviral therapy-related lipodystrophy. AIDS 2001; 15:1643–1651.

7. Mallal SA, John M, Moore CB, James IR, McKinnon EJ. Contribution of nucleoside analogue reverse transcriptase inhibitors to subcutaneous fat wasting in patients with HIV infection. AIDS 2000; 14:1309–1316.

8. Saint-Marc T, Partisani M, Poizot-Martin I, Bruno F, Rouviere O, Lang JM, et al. A syndrome of peripheral fat wasting (lipodystrophy) in patients receiving long-term nucleoside analogue therapy. AIDS 1999; 13:1659–1667.

9. Johnson AA, Ray AS, Hanes J, Suo Z, Colacino JM, Anderson KS, et al. Toxicity of antiviral nucleoside analogs and the human mitochondrial DNA polymerase. J Biol Chem 2001; 276:40847–40857.

10. Kakuda TN. Pharmacology of nucleoside and nucleotide reverse transcriptase inhibitor-induced mitochondrial toxicity. Clin Ther 2000; 22:685–708.

11. Nolan D, Hammond E, Martin A, Taylor L, Herrmann S, McKinnon E, et al. Mitochondrial DNA depletion and morphologic changes in adipocytes associated with nucleoside reverse transcriptase inhibitor therapy. AIDS 2003; 17:1329–1338.

12. Johnson JA, Albu JB, Engelson ES, Ionescu G, Sheikhan J, Kotler DP. Studies of subcutaneous adipose tissue (SAT) in HIV+ subjects with and without lipodystrophy. XIV International AIDS Conference, Barcelona Spain 2002. 7-7-2002. Ref Type: Abstract.

13. Carr A, Workman C, Smith DE, Hoy J, Hudson J, Doong N, et al. Abacavir substitution for nucleoside analogs in patients with HIV lipoatrophy: a randomized trial. JAMA 2002; 288:207–215.

14. McComsey GA, Ward DJ, Hessenthaler SM, Sension MG, Shalit P, Lonergan JT, et al. Improvement in lipoatrophy associated with highly active antiretroviral therapy in human immunodeficiency virus-infected patients switched from stavudine to abacavir or zidovudine: the results of the TARHEEL study. Clin Infect Dis 2004; 38:263–270.

15. Moyle GJ, Baldwin C, Langroudi B, Mandalia S, Gazzard BG. A 48-week, randomized, open-label comparison of three abacavir-based substitution approaches in the management of dyslipidemia and peripheral lipoatrophy. J Acquir Immune Defic Syndr 2003; 33:22–28.

16. Paulsen DM, Hill BJ, Hernandez J, McComsey G, Ross LL. Quantification of mitochondrial DNA in human cells using real-time PCR with fluorogenic reporters. XIV International Conference on AIDS. Barcelona, July 2002 [abstract B4509].

17. Bhat HK, Hiatt WR, Hoppel CL, Brass EP. Skeletal muscle mitochondrial DNA injury in patients with unilateral peripheral arterial disease. Circulation 1999; 99:807–812.

18. Krahenbuhl S, Talso C, Wiesmann U, Hoppel CL. Development and evaluation of a spectrophotometric assay for complex III in isolated mitochondria, tissues and fibroblasts from rats and humans. Clin Chim Acta 1994; 230:177–187.

19. Hoppel CL, Kerr DS, Dahms B, Roessmann U. Deficiency of the reduced nicotinamide adenine dinucleotide dehydrogenase component of complex I of mitochondrial electron transport. Fatal infantile lactic acidosis and hypermetabolism with skeletal-cardiac myopathy and encephalopathy. J Clin Invest 1987; 80:71–77.

20. Zinn AB, Kerr DS, Hoppel CL. Fumarase deficiency: a new cause of mitochondrial encephalomyopathy. N Engl J Med 1986; 315:469–475.

21. Martin JL, Brown CE, Matthews-Davis N, Reardon JE. Effects of antiviral nucleoside analogs on human DNA polymerases and mitochondrial DNA synthesis. Antimicrob Agents Chemother 1994; 38:2743–2749.

22. Cossarizza A, Riva A, Pinti M, Ammannato S, Fedeli P, Mussini C, et al. Increased mitochondrial DNA content in peripheral blood lymphocytes from HIV-infected patients with lipodystrophy. Antivir Ther 2003; 8:315–321.

23. Cote HC, Brumme ZL, Craib KJ, Alexander CS, Wynhoven B, Ting L, et al. Changes in mitochondrial DNA as a marker of nucleoside toxicity in HIV-infected patients. N Engl J Med 2002; 346:811–820.

24. Gahan ME, Miller F, Lewin SR, Cherry CL, Hoy JF, Mijch A, et al. Quantification of mitochondrial DNA in peripheral blood mononuclear cells and subcutaneous fat using real-time polymerase chain reaction. J Clin Virol 2001; 22:241–247.

25. McComsey G, Tan DJ, Lederman M, Wilson E, Wong LJ. Analysis of the mitochondrial DNA genome in the peripheral blood leukocytes of HIV-infected patients with or without lipoatrophy. AIDS 2002; 16:513–518.

26. Shikuma CM, Hu N, Milne C, Yost F, Waslien C, Shimizu S, et al. Mitochondrial DNA decrease in subcutaneous adipose tissue of HIV-infected individuals with peripheral lipoatrophy. AIDS 2001; 15:1801–1809.

27. Cherry CL, Gahan ME, McArthur JC, Lewin SR, Hoy JF, Wesselingh SL. Exposure to dideoxynucleosides is reflected in lowered mitochondrial DNA in subcutaneous fat. J Acquir Immune Defic Syndr 2002; 30:271–277.

28. Rossignol R, Malgat M, Mazat JP, Letellier T. Threshold effect and tissue specificity. Implication for mitochondrial cytopathies. J Biol Chem 1999; 274:33426–33432.

29. Masini A, Scotti C, Calligaro A, Cazzalini O, Stivala LA, Bianchi L, et al. Zidovudine-induced experimental myopathy: dual mechanism of mitochondrial damage. J Neurol Sci 1999; 166:131–140.

30. Barrientos A. In vivo and in organello assessment of OXPHOS activities. Methods 2002; 26:307–316.

31. Canevari L, Clark JB, Bates TE. beta-Amyloid fragment 25-35 selectively decreases complex IV activity in isolated mitochondria. FEBS Lett 1999; 457:131–134.

32. Wredenberg A, Wibom R, Wilhelmsson H, Graff C, Wiener HH, Burden SJ, et al. Increased mitochondrial mass in mitochondrial myopathy mice. Proc Natl Acad Sci USA 2002; 99:15066–15071.

33. Domingo P, Matias-Guiu X, Pujol RM, Francia E, Lagarda E, Sambeat MA, et al. Subcutaneous adipocyte apoptosis in HIV-1 protease inhibitor-associated lipodystrophy. AIDS 1999; 13:2261–22667.

34. Domingo P, Matias-Guiu X, Pujol RM, Domingo JC, Arroyo JA, Sambeat MA, et al. Switching to nevirapine decreases insulin levels but does not improve subcutaneous adipocyte apoptosis in patients with highly active antiretroviral therapy-associated lipodystrophy. J Infect Dis 2001; 184:1197–1201.

Cited By:

This article has been cited 82 time(s).

Clinical Chemistry
Real-time nucleic acid sequence-based amplification assay to quantify changes in mitochondrial DNA concentrations in cell cultures and blood cells from HIV-infected patients receiving antiviral therapy
Timmermans, EC; Tebas, P; Rutter, JPN; Wanders, RJA; De Ronde, A; De Baar, MP
Clinical Chemistry, 52(6): 979-987.
10.1373/clinchem.2005.062901
CrossRef
Hiv Medicine
Haematological changes after switching from stavudine to zidovudine in HIV-infected children receiving highly active antiretroviral therapy
Aurpibul, L; Puthanakit, T; Sirisanthana, T; Sirisanthana, V
Hiv Medicine, 9(5): 317-321.
10.1111/j.1468-1293.2008.00560.x
CrossRef
Hiv Clinical Trials
Increased mtDNA levels without change in mitochondrial enzymes in peripheral blood mononuclear cells of infants born to HIV-infected mothers on antiretroviral therapy
McComsey, GA; Kang, MH; Ross, AC; Lebrecht, D; Livingston, E; Melvin, A; Hitti, J; Cohn, SE; Walker, UA
Hiv Clinical Trials, 9(2): 126-136.
10.1310/hct0902-126
CrossRef
Hiv Medicine
Objective amount of limb fat in HIV-infected subjects with subjective diagnosis of lipoatrophy
Martinez, E; Larrousse, M; Podzamczer, D; Gatell, JM
Hiv Medicine, 10(4): 257-261.
10.1111/j.1468-1293.2008.00680.x
CrossRef
Pharmacogenomics
Pharmacogenetics of nucleoside reverse-transcriptase inhibitor-associated peripheral neuropathy
Kallianpur, AR; Hulgan, T
Pharmacogenomics, 10(4): 623-637.
10.2217/PGS.09.14
CrossRef
Journal of Antimicrobial Chemotherapy
Mitochondrial function, morphology and metabolic parameters improve after switching from stavudine to a tenofovir-containing regimen
Gerschenson, M; Kim, C; Berzins, B; Taiwo, B; Libutti, DE; Choi, J; Chen, D; Weinstein, J; Shore, J; da Silva, B; Belsey, E; McComsey, GA; Murphy, RL
Journal of Antimicrobial Chemotherapy, 63(6): 1244-1250.
10.1093/jac/dkp100
CrossRef
Antiviral Therapy
A 6-month interruption improves adipose tissue of antiretroviral therapy function in HIV-infected patients: the ANRS EP29 Lipostop Study
Kim, MJ; Leclercq, P; Lanoy, E; Cervera, P; Antuna-Puente, B; Maachi, M; Dorofeev, E; Slama, L; Valantin, MA; Costagliola, D; Lombes, A; Bastard, JP; Capeau, J
Antiviral Therapy, 12(8): 1273-1283.

Current Diabetes Reports
Metabolic syndrome associated with HIV and highly active antiretroviral therapy
Barbaro, G; Iacobellis, G
Current Diabetes Reports, 9(1): 37-42.
10.1007/s11892-009-0008-7
CrossRef
Expert Opinion on Drug Safety
Safety of stavudine in the treatment of HIV infection with a special focus on resource-limited settings
Makinson, A; Le Moing, V; Kouanfack, C; Laurent, C; Delaporte, E
Expert Opinion on Drug Safety, 7(3): 283-293.
10.1517/14740330802049781
CrossRef
Revista Da Associacao Medica Brasileira
Cardiovascular Complications in the Acquired Immunodeficiency Syndrome
Barbaro, G; da Silva, EFR
Revista Da Associacao Medica Brasileira, 55(5): 621-630.

Hiv Medicine
British HIV Association (BHIVA) guidelines for the treatment of HIV-infected adults with antiretroviral therapy (2005)
Gazzard, B
Hiv Medicine, 6(): 1-61.

AIDS Research and Human Retroviruses
Changes in the peripheral blood mtDNA levels in naive patients treated by different nucleoside reverse transcriptase inhibitor combinations and their association with subsequent lipodystrophy
Chene, G; Amellal, B; Pedrono, G; Gourlain, K; Rancinan, C; Journot, V; Cotte, L; Palmer, P; De Castro, N; Calvez, V; Molina, JM
AIDS Research and Human Retroviruses, 23(1): 54-61.
10.1089/aid.2006.0039
CrossRef
Clinical Infectious Diseases
Dysregulated energy expenditure in HIV-infected patients: A mechanistic review
Chang, E; Sekhar, R; Patel, S; Balasubramanyam, A
Clinical Infectious Diseases, 44(): 1509-1517.
10.1086/517501
CrossRef
Current Pharmaceutical Design
Visceral fat as target of highly active antiretroviral therapy-associated metabolic syndrome
Barbaro, G
Current Pharmaceutical Design, 13(): 2208-2213.

Expert Opinion on Drug Metabolism & Toxicology
Apoptosis: a clinically useful measure of antiretroviral drug toxicity?
Hooker, DJ; Cherry, CL
Expert Opinion on Drug Metabolism & Toxicology, 5(): 1543-1553.
10.1517/17425250903282781
CrossRef
British Journal of Pharmacology
The accumulation and metabolism of zidovudine in 3T3-F442A pre-adipocytes
Janneh, O; Owen, A; Bray, PG; Back, DJ; Pirmohamed, M
British Journal of Pharmacology, 159(2): 484-493.
10.1111/j.1476-5381.2009.00552.x
CrossRef
Antiviral Therapy
Adipocyte differentiation, mitochondrial gene expression and fat distribution: differences between zidovudine and tenofovir after 6 months
Boothby, M; McGee, KC; Tomlinson, JW; Gathercole, LL; McTernan, PG; Shojaee-Moradie, F; Umpleby, AM; Nightingale, P; Shahmanesh, M
Antiviral Therapy, 14(8): 1089-1100.
10.3851/IMP1457
CrossRef
Antiviral Therapy
Muscle and liver lactate metabolism in HAART-treated and naive HIV-infected patients: the MITOVIR study
Ghosn, J; Guiguet, M; Jardel, C; Benyaou, R; Zeller, V; Simon, A; Valantin, MA; Amellal, B; Assoumo, L; Hogrel, JY; Costogliola, D; Kotlama, C; Lombes, A
Antiviral Therapy, 10(4): 543-550.

Chemotherapy
Highly active antiretroviral therapy-associated metabolic syndrome and cardiovascular risk
Barbaro, G; Barbarini, G
Chemotherapy, 52(4): 161-165.
10.1159/000093034
CrossRef
Journal of Infectious Diseases
Changes in body composition and mitochondrial nucleic acid content in patients switched from failed nucleoside analogue therapy to Ritonavir-boosted Indinavir and Efavirenz
Boyd, MA; Carr, A; Ruxrungtham, K; Srasuebkul, P; Bien, D; Law, M; Wangsuphachart, S; Krisanachinda, A; Lerdlum, S; Lange, JMA; Phanuphak, P; Cooper, DA; Reiss, P
Journal of Infectious Diseases, 194(5): 642-650.

Hiv Medicine
Recovery of fat following a switch to nucleoside reverse transcriptase inhibitor-sparing therapy in patients with lipoatrophy: results from the 96-week randomized ANRS 108 NoNuke Trial
Valantin, MA; Lanoy, E; Bentata, M; Kalmykova, O; Boutekadjirt, A; Allavena, C; Rozenbaum, W; Peytavin, G; Amellal, B; Calvez, V; Costagliola, D; Katlama, C
Hiv Medicine, 9(8): 625-635.
10.1111/j.1468-1293.2008.00606.x
CrossRef
Journal of Medical Virology
Depleted skeletal muscle mitochondrial DNA, hyperlactatemia, and decreased oxidative capacity in HIV-infected patients on highly active antiretroviral therapy
Haugaard, SB; Andersen, O; Pedersen, SB; Dela, F; Richelsen, B; Nielsen, JO; Madsbad, S; Iversen, J
Journal of Medical Virology, 77(1): 29-38.
10.1002/jmv.20410
CrossRef
Clinical Infectious Diseases
Effects of potent antiretroviral therapy on free testosterone levels and fat-free mass in men in a prospective, randomized trial: A5005s, a substudy of AIDS clinical trials group study 384
Dube, MP; Parker, RA; Mulligan, K; Tebas, P; Robbins, GK; Roubenoff, R; Grinspoon, SK
Clinical Infectious Diseases, 45(1): 120-126.
10.1086/518620
CrossRef
International Journal of Obesity
Lipodystrophy in HIV 1-infected patients: lessons for obesity research
Villarroya, F; Domingo, P; Giralt, M
International Journal of Obesity, 31(): 1763-1776.
10.1038/sj.ijo.0803698
CrossRef
Antiviral Therapy
Partial immunological and mitochondrial recovery after reducing didanosine doses in patients on didanosine and tenofovir-based regimens
Negredo, E; Garrabou, G; Puig, J; Lopez, S; Moren, C; Bellido, R; Ayen, R; Cardellach, F; Miro, O; Clotet, B
Antiviral Therapy, 13(2): 231-240.

AIDS
Effect of treatment interruption monitored by CD4 cell count on mitochondrial DNA content in HIV-infected patients: a prospective study
Mussini, C; Pinti, M; Bugarini, R; Borghi, V; Nasi, M; Nemes, E; Troiano, L; Guaraldi, G; Bedini, A; Sabin, C; Esposito, R; Cossarizza, A
AIDS, 19(): 1627-1633.

Clinical Infectious Diseases
Rolling out antiretrovirals in Africa: There are still challenges ahead
Colebunders, R; Ronald, A; Katabira, E; Sande, M
Clinical Infectious Diseases, 41(3): 386-389.

Antiviral Therapy
Nucleoside analogues toxicities related to mitochondrial dysfunction: focus on HIV-infected children
Vigano, A; Giacomet, V
Antiviral Therapy, 10(): M53-M64.

Revue Neurologique
Mitochondrial cytopathies associated with HIV infection
Gerard, Y; Melliez, H; Mouton, Y; Yazdanpanah, Y
Revue Neurologique, 162(1): 62-70.

Journal of Antimicrobial Chemotherapy
Exploratory study comparing the metabolic toxicities of a lopinavir/ritonavir plus saquinavir dual protease inhibitor regimen versus a lopinavir/ritonavir plus zidovudine/lamivudine nucleoside regimen
Cameron, DW; Becker, S; King, MS; da Silva, B; Klein, C; Tokimoto, D; Foit, C; Calhoun, D; Bernstein, B; Hanna, GJ
Journal of Antimicrobial Chemotherapy, 59(5): 957-963.
10.1093/jac/dkm029
CrossRef
Clinical Infectious Diseases
Effect of reducing the dose of stavudine on body composition, bone density, and markers of mitochondrial toxicity in HIV-infected subjects: A randomized, controlled study
McComsey, GA; Lo Re, V; O'Riordan, M; Walker, UA; Lebrecht, D; Baron, E; Mounzer, K; Frank, I
Clinical Infectious Diseases, 46(8): 1290-1296.
10.1086/529384
CrossRef
Antiviral Therapy
Mitochondrial RNA and DNA alterations in HIV lipoatrophy are linked to antiretroviral therapy and not to HIV infection
McComsey, GA; Libutti, DE; O'Riordan, M; Shelton, JM; Storer, N; Ganz, J; Jasper, J; Harrill, D; Gerschenson, M
Antiviral Therapy, 13(5): 715-722.

Antimicrobial Agents and Chemotherapy
Mitochondrial DNA content, an inaccurate biomarker of mitochondrial alteration in human immunodeficiency virus-related lipodystrophy
Kim, MJ; Jardel, C; Barthelemy, C; Jan, W; Bastard, JP; Fillaut-Chapin, S; Houry, S; Capeau, J; Lombes, A
Antimicrobial Agents and Chemotherapy, 52(5): 1670-1676.
10.1128/AAC.01449-07
CrossRef
European Journal of Clinical Nutrition
Uridine supplementation in HIV lipoatrophy: pilot trial on safety and effect on mitochondrial indices
McComsey, GA; O'Riordan, M; Setzer, B; Lebrecht, D; Baron, E; Walker, UA
European Journal of Clinical Nutrition, 62(8): 1031-1037.
10.1038/sj.ejcn.1602793
CrossRef
AIDS Research and Human Retroviruses
A Longitudinal Study of the Changes in Body Fat and Metabolic Parameters in a South African Population of HIV-Positive Patients Receiving an Antiretroviral Therapeutic Regimen Containing Stavudine
George, JA; Venter, WDF; Van Deventer, HE; Crowther, NJ
AIDS Research and Human Retroviruses, 25(8): 771-781.
10.1089/aid.2008.0308
CrossRef
Antiviral Therapy
Altered mitochondrial RNA production in adipocytes from HIV-infected individuals with lipodystrophy
Galluzzi, L; Pinti, M; Guaraldi, G; Mussini, C; Troigno, L; Roat, E; Giovenzana, C; Nemes, E; Nasi, M; Orlando, G; Solomoni, P; Cossarizza, A
Antiviral Therapy, 10(): M91-M99.

Hiv Clinical Trials
Changes in body fat measured by DEXA in patients taking different formulations of stavudine
Yang, Y; Wilder-Smith, A; Panchalingam, A; Tha, NO; Paton, NI
Hiv Clinical Trials, 6(6): 337-343.

Hiv Clinical Trials
Subjective Clinical Lipoatrophy Assessment Correlates with DEXA-Measured Limb Fat
Tungsiripat, M; O'Riordan, MA; Storer, N; Harrill, D; Ganz, J; Libutti, D; Gerschenson, M; McComsey, GA
Hiv Clinical Trials, 10(5): 314-319.
10.1310/hct1005-314
CrossRef
American Journal of Clinical Dermatology
Dermatologic adverse effects of Antiretroviral therapy
Luther, J; Glesby, MJ
American Journal of Clinical Dermatology, 8(4): 221-233.

Journal of Antimicrobial Chemotherapy
HIV and mitochondrial toxicity in children
Foster, C; Lyall, H
Journal of Antimicrobial Chemotherapy, 61(1): 8-12.
10.1093/jac/dkm411
CrossRef
Journal of Antimicrobial Chemotherapy
Mitochondrial toxicity in HIV-infected patients both off and on antiretroviral treatment: a continuum or distinct underlying mechanisms?
Maagaard, A; Kvale, D
Journal of Antimicrobial Chemotherapy, 64(5): 901-909.
10.1093/jac/dkp316
CrossRef
Antiviral Therapy
Possible ways nucleoside analogues can affect mitochondrial DNA content and gene expression during HIV therapy
Cote, HCF
Antiviral Therapy, 10(): M3-M11.

Antiviral Therapy
Mitochondrial (mt)DNA changes in tissue may not be reflected by depletion of mtDNA in peripheral blood mononuclear cells in HIV-infected patients
Maagaard, A; Holberg-Petersen, M; Kollberg, G; Oldfors, A; Sandvik, L; Bruun, JN
Antiviral Therapy, 11(5): 601-608.

Drug Safety
Mitochondrial disorders among infants exposed to HIV and antiretroviral therapy
Funk, MJ; Belinson, SE; Pimenta, JM; Morsheimer, M; Gibbons, DC
Drug Safety, 30(): 845-859.

Clinical Infectious Diseases
Blepharoptosis and external ophthalmoplegia associated with long-term antiretroviral therapy
Dinges, WL; Witherspoon, SR; Itani, KM; Garg, A; Peterson, DM
Clinical Infectious Diseases, 47(6): 845-852.
10.1086/591202
CrossRef
Antiviral Therapy
Mitochondrial studies in HAART-related lipodystrophy: from experimental hypothesis to clinical findings
Miro, O; Lopez, S; Cardellach, F; Casademont, J
Antiviral Therapy, 10(): M73-M81.

Antiviral Therapy
Mitochondrial DNA levels of peripheral blood mononuclear cells and subcutaneous adipose tissue from thigh, fat and abdomen of HIV-1 seropositive and negative individuals
Gerschenson, M; Shiramizu, B; LiButti, DE; Shikuma, CM
Antiviral Therapy, 10(): M83-M89.

AIDS Reviews
Switching strategies to improve lipid profile and morphologic changes
Barragan, P; Fisac, C; Podzamczer, D
AIDS Reviews, 8(4): 191-203.

Expert Opinion on Drug Metabolism & Toxicology
Toxic metabolic syndrome associated with HAART
Haugaard, SB
Expert Opinion on Drug Metabolism & Toxicology, 2(3): 429-445.
10.1517/17425255.2.3.429
CrossRef
Clinical Infectious Diseases
Adverse effects of highly active antiretroviral therapy in developing countries
Subbaraman, R; Chaguturu, SK; Mayer, KH; Flanigan, TP; Kumarasamy, N
Clinical Infectious Diseases, 45(8): 1093-1101.
10.1086/521150
CrossRef
Antimicrobial Agents and Chemotherapy
Impact of nucleoside reverse transcriptase inhibitors on mitochondria in human immunodeficiency virus type 1-infected children receiving highly active antiretroviral therapy
Saitoh, A; Fenton, T; Alvero, C; Fletcher, CV; Spector, SA
Antimicrobial Agents and Chemotherapy, 51(): 4236-4242.
10.1128/AAC.00893-07
CrossRef
Scandinavian Journal of Infectious Diseases
Long term adverse effects related to nucleoside reverse transcriptase inhibitors: Clinical impact of mitochondrial toxicity
Maagaard, A; Kvale, D
Scandinavian Journal of Infectious Diseases, 41(): 808-817.
10.3109/00365540903186181
CrossRef
Clinical Infectious Diseases
Noninvasive diagnosis of mitochondrial dysfunction in HAART-related hyperlactatemia
Garrabou, G; Sanjurjo, E; Miro, O; Martinez, E; Infante, AB; Lopez, S; Cardellach, F; Gatell, JM; Casademont, J
Clinical Infectious Diseases, 42(4): 584-585.

Antiviral Therapy
Uridine abrogates the adverse effects of antiretroviral pyrimidine analogues on adipose cell functions
Walker, UA; Auclair, M; Lebrecht, D; Kornprobst, M; Capeau, J; Caron, M
Antiviral Therapy, 11(1): 25-34.

AIDS Reviews
Pathogenesis of lipodystrophy and lipid abnormalities in patients taking antiretroviral therapy
Mallon, PWG
AIDS Reviews, 9(1): 3-15.

Antiviral Therapy
Substitutions due to antiretroviral toxicity or contraindication in the first 3 years of antiretroviral therapy in a large South African cohort
Boulle, A; Orrell, C; Kaplan, R; Van Cutsem, G; McNally, M; Hilderbrand, K; Myer, L; Egger, M; Coetzee, D; Maartens, G; Wood, R
Antiviral Therapy, 12(5): 753-760.

Antiviral Therapy
Metabolic and mitochondrial effects of switching antiretroviral-experienced patients to enfuvirtide, tenofovir and saquinavir/ritonavir
Miro, O; Garrabou, G; Lopez, S; Deig, E; Vidal, I; Infante, AB; Cardellach, F; Casademont, J; Pedrol, E
Antiviral Therapy, 11(5): 625-630.

Antiviral Therapy
Relationship of mitochondrial DNA depletion and respiratory chain activity in preadipocytes treated with nucleoside reverse transcriptase inhibitors
Stankov, MV; Lucke, T; Das, AM; Schmidt, RE; Behrens, GMN
Antiviral Therapy, 12(2): 205-216.

Journal of Infectious Diseases
Gene Expression and Immunohistochemistry in Adipose Tissue of HIV Type 1-Infected Patients with Nucleoside Analogue Reverse-Transcriptase Inhibitor-Associated Lipoatrophy
Sievers, M; Walker, UA; Sevastianova, K; Setzer, B; Wagsater, D; Eriksson, P; Yki-Jarvinen, H; Sutinen, J
Journal of Infectious Diseases, 200(2): 252-262.
10.1086/599986
CrossRef
Pediatrics
Antiretroviral Exposure and Lymphocyte mtDNA Content Among Uninfected Infants of HIV-1-Infected Women
Aldrovandi, GM; Chu, C; Shearer, WT; Li, D; Walter, J; Thompson, B; McIntosh, K; Foca, M; Meyer, WA; Ha, BF; Rich, KC; Moye, J
Pediatrics, 124(6): E1189-E1197.
10.1542/peds.2008-2771
CrossRef
Current Hiv Research
Mild Improvement in Mitochondrial Function After a 3-Year Antiretroviral Treatment Interruption Despite Persistent Impairment of Mitochondrial DNA Content
Negredo, E; Romeu, J; Rodriguez-Santiago, B; Miro, O; Garrabou, G; Puig, J; Perez-Alvarez, N; Moren, C; Ruiz, L; Bellido, R; Miranda, C; Clotet, B
Current Hiv Research, 8(5): 379-385.

International Journal of Std & AIDS
The cost of antiretroviral drugs and influence on prescribing policies
Jones, R; Gazzard, B
International Journal of Std & AIDS, 17(8): 499-506.

Obesity
Mitochondrial DNA: An Up-and-coming Actor in White Adipose Tissue Pathophysiology
Villarroya, J; Giralt, M; Villarroya, F
Obesity, 17(): 1814-1820.
10.1038/oby.2009.152
CrossRef
Antimicrobial Agents and Chemotherapy
Mitochondrial DNA Depletion and Respiratory Chain Activity in Primary Human Subcutaneous Adipocytes Treated with Nucleoside Analogue Reverse Transcriptase Inhibitors
Stankov, MV; Lucke, T; Das, AM; Schmidt, RE; Behrens, GMN
Antimicrobial Agents and Chemotherapy, 54(1): 280-287.
10.1128/AAC.00914-09
CrossRef
Pharmacogenomics
Pharmacogenetic information derived from analysis of HLA alleles
Gatanaga, H; Honda, H; Oka, S
Pharmacogenomics, 9(2): 207-214.
10.2217/14622416.9.2.207
CrossRef
AIDS Research and Human Retroviruses
Mitochondrial Oxidative Phosphorylation Protein Levels in Peripheral Blood Mononuclear Cells Correlate with Levels in Subcutaneous Adipose Tissue within Samples Differing by HIV and Lipoatrophy Status
Shikuma, CM; Gerschenson, M; Chow, D; Libutti, DE; Willis, JH; Murray, J; Capaldi, RA; Marusich, M
AIDS Research and Human Retroviruses, 24(): 1255-1262.
10.1089/aid.2007.0262
CrossRef
Southern African Journal of Hiv Medicine
Abacavir: Its Use and Hypersensitivity
Rabie, H; Henning, KL; Schoeman, P; de Villiers, N; Pretorius, GHJ; Cotton, MF
Southern African Journal of Hiv Medicine, (): 81-84.

Current Hiv Research
Metabolic and cardiovascular complications of highly active antiretroviral therapy for HIV infection
Barbaro, G
Current Hiv Research, 4(1): 79-85.

AIDS Research and Human Retroviruses
Physical Fitness in Children Infected with the Human Immunodeficiency Virus: Associations with Highly Active Antiretroviral Therapy
Somarriba, G; Lopez-Mitnik, G; Ludwig, DA; Neri, D; Schaefer, N; Lipshultz, SE; Scott, GB; Miller, TL
AIDS Research and Human Retroviruses, 29(1): 112-120.
10.1089/aid.2012.0047
CrossRef
AIDS Research and Human Retroviruses
Polymorphisms in Fas Gene Is Associated with HIV-Related Lipoatrophy in Thai Patients
Likanonsakul, S; Rattanatham, T; Feangvad, S; Uttayamakul, S; Prasithsirikul, W; Srisopha, S; Nitiyanontakij, R; Tengtrakulcharoen, P; Tarkowski, M; Riva, A; Nakayama, EE; Shioda, T
AIDS Research and Human Retroviruses, 29(1): 142-150.
10.1089/aid.2012.0114
CrossRef
Cytometry Part B-Clinical Cytometry
Quantification of mitochondrial toxicity in HIV-infected individuals by quantitative PCR compared to flow cytometry
Wagner, TA; Lin, CH; Tobin, NH; Cote, HCF; Sloan, DD; Jerome, KR; Frenkel, LM
Cytometry Part B-Clinical Cytometry, 84B(1): 55-58.
10.1002/cyto.b.21045
CrossRef
AIDS
Effects of metformin and rosiglitazone in HIV-infected patients with hyperinsulinemia and elevated waist/hip ratio
Mulligan, K; Yang, Y; Wininger, DA; Koletar, SL; Parker, RA; Alston-Smith, BL; Schouten, JT; Fielding, RA; Basar, MT; Grinspoon, S
AIDS, 21(1): 47-57.
10.1097/QAD.0b013e328011220e
PDF (175) | CrossRef
AIDS
Rosiglitazone improves lipoatrophy in patients receiving thymidine-sparing regimens
Tungsiripat, M; Bejjani, DE; Rizk, N; O'Riordan, MA; Ross, AC; Hileman, C; Storer, N; Harrill, D; McComsey, GA
AIDS, 24(9): 1291-1298.
10.1097/QAD.0b013e328339e274
PDF (208) | CrossRef
AIDS
Genetic polymorphisms differently influencing the emergence of atrophy and fat accumulation in HIV-related lipodystrophy
Zanone Poma, B; Riva, A; Nasi, M; Cicconi, P; Broggini, V; Lepri, AC; Mologni, D; Mazzotta, F; Monforte, AD; Mussini, C; Cossarizza, A; Galli, M; for the Icona Foundation Study Group,
AIDS, 22(14): 1769-1778.
10.1097/QAD.0b013e32830b3a96
PDF (281) | CrossRef
AIDS
Increased regimen durability in the era of once-daily fixed-dose combination antiretroviral therapy
Willig, JH; Abroms, S; Westfall, AO; Routman, J; Adusumilli, S; Varshney, M; Allison, J; Chatham, A; Raper, JL; Kaslow, RA; Saag, MS; Mugavero, MJ
AIDS, 22(15): 1951-1960.
10.1097/QAD.0b013e32830efd79
PDF (159) | CrossRef
European Journal of Gastroenterology & Hepatology
Hepatic histopathology and clinical characteristics associated with antiretroviral therapy in HIV patients without viral hepatitis
Akhtar, MA; Mathieson, K; Arey, B; Post, J; Prevette, R; Hillier, A; Patel, P; Ram, LJ; Van Thiel, DH; Nadir, A
European Journal of Gastroenterology & Hepatology, 20(12): 1194-1204.
10.1097/MEG.0b013e328305b9e0
PDF (858) | CrossRef
JAIDS Journal of Acquired Immune Deficiency Syndromes
Durability of Initial Antiretroviral Therapy in a Resource-Constrained Setting and the Potential Need for Zidovudine Weight-Based Dosing
Tomatis, C; Saag, MS; Gotuzzo, E; Willig, JH; Echevarria, J; Westfall, AO; Iglesias, D; Henostroza, G; Seas, C; Mugavero, MJ; Allison, J; Paz, J; Hernandez, F
JAIDS Journal of Acquired Immune Deficiency Syndromes, 53(2): 215-221.
10.1097/QAI.0b013e3181bc0f10
PDF (312) | CrossRef
JAIDS Journal of Acquired Immune Deficiency Syndromes
Increased Adipocyte Apoptosis in Lipoatrophy Improves Within 48 Weeks of Switching Patient Therapy From Stavudine to Abacavir or Zidovudine
Cherry, CL; Lal, L; Thompson, KA; McLean, CA; Ross, LL; Hernandez, J; Wesselingh, SL; McComsey, G
JAIDS Journal of Acquired Immune Deficiency Syndromes, 38(3): 263-267.

PDF (135)
JAIDS Journal of Acquired Immune Deficiency Syndromes
Extensive Investigations of Mitochondrial DNA Genome in Treated HIV-Infected Subjects: Beyond Mitochondrial DNA Depletion
McComsey, G; Bai, R; Maa, J; Seekins, D; Wong, L
JAIDS Journal of Acquired Immune Deficiency Syndromes, 39(2): 181-188.

PDF (157)
JAIDS Journal of Acquired Immune Deficiency Syndromes
Genetic and Functional Mitochondrial Assessment of HIV-Infected Patients Developing HAART-Related Hyperlactatemia
Garrabou, G; Morén, C; Gallego-Escuredo, JM; Milinkovic, A; Villarroya, F; Negredo, E; Giralt, M; Vidal, F; Pedrol, E; Martínez, E; Cardellach, F; Gatell, JM; Miró, Ò
JAIDS Journal of Acquired Immune Deficiency Syndromes, 52(4): 443-451.
10.1097/QAI.0b013e3181bd564c
PDF (287) | CrossRef
The Pediatric Infectious Disease Journal
Effects of the Change From Stavudine to Tenofovir in Human Immunodeficiency Virus-Infected Children Treated With Highly Active Antiretroviral Therapy: Studies on Mitochondrial Toxicity and Thymic Function
Rosso, R; Nasi, M; Di Biagio, A; Repetto, E; Dentone, C; Pinti, M; Nemes, E; Ferraresi, R; Mussini, C; Esposito, R; Viscoli, C; Cossarizza, A
The Pediatric Infectious Disease Journal, 27(1): 17-21.
10.1097/INF.0b013e31814689be
PDF (206) | CrossRef
Journal of Clinical Psychopharmacology
Neuroleptic Treatment Effect on Mitochondrial Electron Transport Chain: Peripheral Blood Mononuclear Cells Analysis in Psychotic Patients
Casademont, J; Garrabou, G; Miró, Ò; López, S; Pons, A; Bernardo, M; Cardellach, F
Journal of Clinical Psychopharmacology, 27(3): 284-288.
10.1097/JCP.0b013e318054753e
PDF (259) | CrossRef
Back to Top | Article Outline
Keywords:

stavudine; abacavir; mitochondrial DNA; mitochondrial toxicity; electron transport chain; apoptosis; lipoatrophy

© 2005 Lippincott Williams & Wilkins, Inc.

Login

Search for Similar Articles
You may search for similar articles that contain these same keywords or you may modify the keyword list to augment your search.