Skip Navigation LinksHome > January 2, 2004 - Volume 18 - Issue 1 > Impact of 5 years of maximally successful highly active anti...
AIDS:
Basic Science: Concise Communications

Impact of 5 years of maximally successful highly active antiretroviral therapy on CD4 cell count and HIV-1 DNA level

Viard, Jean-Paula,c; Burgard, Marianneb,c; Hubert, Jean-Baptisted; Aaron, Laurenta; Rabian, Cécilea; Pertuiset, Nathaliec; Lourenço, Mariab; Rothschild, Chantalc; Rouzioux, Christineb,e

Free Access
Article Outline
Collapse Box

Author Information

From the aService d'Immunologie Clinique, bLaboratoire de Virologie, cCentre de Traitement de l'Hémophilie, Centre Hospitalier Universitaire Necker-Enfants Malades, Paris, dINSERM U569, Hôpital de Bicêtre, Bicêtre and eEA MRT 3620, Université René-Descartes, Faculté de Médecine Necker-Enfants Malades, Paris, France.

Requests for reprints to: Dr Jean-Paul Viard, Service d'Immunologie Clinique, Hôpital Necker, 149, rue de Sèvres, 75743 Paris Cedex 15, France.

Received: 15 January 2003; revised: 2 May 2003; accepted: 23 June 2003.

Collapse Box

Abstract

Objectives: To evaluate the impact on CD4 cell count and HIV-1 DNA level in peripheral blood mononuclear cells (PBMC) of long-term highly active antiretroviral therapy (HAART) in the setting of maximal success, i.e., constant plasma HIV-1 RNA load suppression.

Design: Retrospective analysis of patients selected for a constantly undetectable plasma HIV-1 RNA load since HAART initiation.

Methods: HIV-1 DNA was measured in PBMC using a real-time polymerase chain reaction assay. Loess estimates and regression analysis were used for modelling the variations of the CD4 cell count and HIV DNA level over time.

Results: The study included 41 patients chronically infected with HIV-1 who had been taking HAART for a median duration of 60.4 months and had an undetectable plasma HIV RNA load ever since the first 6 months of HAART; 25 were tested for HIV-1 DNA. The mean CD4 cell count increase was high during the first 18 months on therapy (168 × 106 cells/l per year), much lower afterwards (38 × 106 cells/l per year), independently of the baseline CD4 cell count. Most of the patients (73.2%) reached a CD4 cell count constantly ≥ 400 × 106/l during follow-up. HIV-1 DNA showed a mean decrease of 0.48 log10 copies/106 PBMC during the first year, of 0.18 log10 copies/106 PBMC per year during the 2nd and 3rd years, but no significant decrease afterwards.

Conclusions: These results question the benefit of very long-term maintenance of HAART in terms of CD4 gain and HIV-1 DNA reduction.

Back to Top | Article Outline

Introduction

Treatment of chronic HIV-1 infection with highly active antiretroviral therapy (HAART) allows a drastic reduction of plasma HIV-1 RNA load, responsible for immune restoration. However, virus eradication is not a realistic goal because viral reservoirs established in body and cell compartments are either not susceptible to the action of antiretroviral drugs or characterized by long half-life and slow turnover [1]. Measurement of HIV-1 DNA in peripheral blood mononuclear cells (PBMC) gives access to the viral reservoir, since cell-associated HIV-1 DNA reflects both actively and latently infected cells [2].

Here, the evolution of the HIV-1 DNA load and of the CD4 cell count was assessed in HIV-1-infected patients selected for maximally successful viral suppression on HAART in the long term, which allows for maximal immune restoration [3]. These parameters are relevant to the issue of treatment discontinuation or maintenance in patients experiencing virological and immunological success after several years on HAART.

Back to Top | Article Outline

Methods

Subjects

Patients with HIV-1 infection followed at a single institution (Necker Hospital) were retrospectively selected on the basis of (i) undetectable plasma HIV-1 RNA load (< 400 or < 50 copies/ml) within 6 months of starting their first HAART regimen between May 1996 and April 1997; (ii) undetectable plasma HIV-1 RNA since month 6 of HAART, without either replication (`blips') > 400 copies/ml or treatment interruption; and (iii) follow-up for more than 48 months. Sampling once a year for HIV-1 DNA measurement was carried out in patients who gave agreement. All patients were prospectively evaluated clinically and for CD4 cell count and plasma HIV-1 RNA [median interval between visits, 3 months; median number of measurements, 20, interquartile range (IQR), 17–21]. Informed consent was obtained from study participants.

From May 1996 to April 1997, 217 subjects started HAART. Among them, 13 died, 19 were lost to follow-up and 41 (18.9% in an intent-to-treat analysis) met the very stringent criteria set for this study of permanent plasma HIV-1 RNA suppression; of these, 25 were tested for HIV-1 DNA.

Back to Top | Article Outline
Quantification of HIV-1 RNA in plasma

Blood was sampled in ethylenediaminetetraacetic acid (EDTA) and plasma was frozen at −80°C within 6 hours of collection. Plasma HIV-1 RNA was measured with the Amplicor HIV Monitor assay (Roche Diagnostic Systems, Neuilly, France). From September 1997, samples were systematically tested using the ultrasensitive procedure (detection limit 50 copies/ml).

Back to Top | Article Outline
Quantification of HIV-1 DNA in peripheral blood mononuclear cells

Blood samples collected in EDTA were separated into plasma and cells by Ficoll–Hypaque density gradient centrifugation (Eurobio, Les Ulis, France) and dry pellets of 106 PBMC were stored at −80°C. Total cell DNA was extracted from pellets by adsorption on silica membranes (Qiagen, Hilden, Germany) and stored at −80°C. HIV-1 DNA was quantified by real-time polymerase chain reaction, using 5′ nuclease assay in the long terminal repeat (LTR) gene [4]. The reaction was performed with ABI PRISM 7000 (Applied Biosystems, Courtaboeuf, France). Briefly, 1 μg DNA was amplified with the sense primer NEC 152 (GCCT CAATAAAGCTTGCCTTGA) and the reverse primer NEC 131 (GGCGCCACTGCTAGAGATTTT) in the presence of a dually (FAM and TAMRA) labelled NEC LTR probe (AAGTAGTGTGTGCCCGTCTG TTRTKTGACT). The first PCR cycle allowing fluorescence detection permitted to quantify HIV-1 DNA by reference to a standard curve (fivefold dilutions of 8E5 cell DNA). All samples from each patient were tested in the same assay. Results were expressed as number of DNA copies/106 PBMC.

Back to Top | Article Outline
CD4 cell count

Absolute CD4 cell count was determined by flow cytometry on a FACScan (Becton-Dickinson, San Jose, California, USA) equipped with the CellQuest software.

Back to Top | Article Outline
Statistical analysis

A chi-square or a Mann–Whitney U test was used for categorical or continuous variables, respectively, in comparison of two groups. Trajectories of CD4 cell counts and log10-transformed HIV-1 DNA levels were described by using the Loess procedure, which draws a representative smooth curve through data by using robust local regressions [5]. For each marker, a piecewise linear regression analysis was performed with one or two change points to estimate and test mean slopes at different periods after HAART initiation. Time at which changes occurred were determined according to the inflexion points observed in the Loess curves. All tests were two-sided. Statistical analysis was performed by use of Statview (Abacus Concepts, Berkeley, California, USA) and SAS v.8.1 (SAS Institute, Cary, North Carolina, USA).

Back to Top | Article Outline

Results

Study population

Table 1 shows the characteristics of the 41 patients on HAART for a median of 60.4 months (range, 50–71) who entered the study. Two died at month 61 of HAART, one of terminal liver failure and one of lymphoma, but still had undetectable plasma HIV RNA loads. All others were clinically well, except for the lipodystrophy syndrome, present in 58.5%.

Table 1
Table 1
Image Tools

All studied patients started with a regimen including two nucleoside analogues and one protease inhibitor, indinavir in 93%. For intolerance reasons, some patients switched to another protease inhibitor or a non-nucleosidic reverse transcriptase inhibitor, and some changed nucleoside analogues. At time of analysis, 48% of patients were still on their first-line regimen, and 87% were taking a protease inhibitor.

The 25 patients studied for HIV-1 DNA were slightly younger and had moderately lower CD4 cell count nadir, plasma viral load zenith and pre-HAART plasma RNA level than the 16 patients who were not sampled for HIV-1 DNA. Otherwise, they did not differ in terms of medical and therapeutic history.

Back to Top | Article Outline
Immune restoration

Loess estimates of CD4 cell count on HAART (Fig. 1) showed a marked increase during the first 18 months, much lower afterwards. Using a piecewise linear regression analysis, the following estimations of the mean CD4 cell count slopes were obtained: 168 × 106 cells/l per year (SD, 20) during the first 18 months and subsequently 38 × 106 cells/l per year (SD, 9). CD4 cell count slopes differed significantly from zero (P < 10−4 at each period) and the increase was significantly lower after than before the 18th month (P < 10−4). The CD4 cell count increase was similar for patients in the upper and lower halves of pre-HAART CD4 cell count values (median, 135 × 106 cells/l), before (P = 0.30) as well as after (P = 0.24) the 18th month.

Fig. 1
Fig. 1
Image Tools

The proportion of patients reaching a CD4 cell count constantly ≥ 400 × 106/l until the end of follow-up was analysed (patients with at least two measurements during the period were considered, and all values ≥ 400 × 106/l): 30 patients out of 41 (73.2%) reached this endpoint during follow-up; 11 (52.4%) and 19 (95 %) of the patients with baseline CD4 cell counts below and above the median, respectively (P < 0.01). A CD4 cell count of ≥ 400 × 106/l was achieved in 10 of the 41 patients (24.4%) between months 6 and 18 of HAART: two (9.5%) with baseline CD4 cell counts below the median and eight (40%) with counts above the median (P = 0.04). Between months 30 and 42, 23 patients out of 41 (56.1%) met this endpoint [five (23.8%) with baseline CD4 cell counts below the median and 18 (90%) with counts above the median; P < 0.001], and between months 54 and 66, 23 patients out of 33 (69.7%) fulfilled this criterion [8 out of 17 (47%) with baseline CD4 cell counts below the median and 15 out of 16 (94%) with counts above the median; P < 0.01]. Thirty-six of the patients (87.5%) who had CD4 cell counts ≥ 400 × 106/l between months 6 and 18 kept this status at 3 years; 38 (93.8%) of the patients who reached ≥ 400 × 106/l at year 3 still had CD4 cell counts ≥ 400 × 106/l at year 5.

Back to Top | Article Outline
Evolution of HIV-1 DNA during therapy

The Loess curve of HIV-1 DNA decrease on HAART (Fig. 1) showed mild inflexions after 1 year and after 3 years, and this overall pattern applied for all patients. Introducing two change points in the regression model, the following estimations were obtained: mean decrease of 0.48 log10 copies/106 PBMC (SD, 0.19) during the first year, 0.18 log10 copies/106 PBMC per year (SD, 0.08) during the 2nd and 3rd years, and 0.01 log10 copies/106 PBMC per year (SD, 0.07) afterwards. The slopes for the first two periods were significantly different from zero (P = 0.012 and P = 0.025, respectively), while that for the third period was not (P = 0.94). However, the difference between the first two slopes did not reach statistical significance (P = 0.20), which may be because of a lack of statistical power linked to the small size of the study group. The evolution of HIV DNA was not different for patients with baseline CD4 cell counts above or below median value.

Back to Top | Article Outline

Discussion

Since HAART has no direct effect on integrated virus and is only virustatic, virus is stored in resting CD4 T cells, and a low level of viraemia persists even in patients with undetectable plasma HIV RNA load [1]. Therefore, any beneficial impact of the long-term maintenance of HAART on the HIV-1 reservoir is elusive. The measurement of cell-associated HIV-1 DNA can be used as a tool to study the effects of HAART on the cell-associated reservoir.

The evolution of HIV-1 DNA has been studied in the short and mid term in patients taking HAART. In studies of chronic infection, HIV-1 DNA decreased by approximately 0.4 log10 copies/106 PBMC during the first year [6,7] and reached a plateau after approximately 80 weeks [2,8]. In HAART-treated primary infection, a more pronounced decrease of HIV-1 DNA has been described: 0.78 log10 copies/106 PBMC after 1 year [9], 1.0 log10 copies/106 PBMC after 18 months [10] (and even 0.9 log10 copies/106 PBMC at 48 weeks under the effect of both HAART and interferon-α [11]), with a slower decay rate after 3 months, linked to residual replication [12]. At HAART interruption, HIV-1 DNA in PBMC has been shown to rise rapidly [13] and decrease more rapidly at treatment resumption than at first HAART prescription. This indicates that, under these circumstances, a pool of recently infected cells contributes to the level of HIV-1 DNA, which is only partly the case in chronic infection. The HIV-1 DNA level, assessed by a test measuring both integrated and unintegrated DNA (as in the present study), has also been shown to be a prognostic marker of HIV-1 infection, independent of the CD4 cell count and plasma RNA load [14,15]. Therefore, HIV-1 DNA in PBMC will reflect not only recently infected cells but also the solidly established stock of virus in the body, present since a very early step in the natural history of infection, and only partially reduced by HAART in the short and mid term, particularly in chronic infection.

The present study, although limited in its conclusions by the small number of patients, stresses the levelling off, with time, of the effects of HAART. Extending previous data [2,4,6,8], non-parametric estimation and regression analysis of HIV-1 DNA over a 5-year follow-up showed a homogeneous pattern in the patients studied: an initial decay of 0.5 log10 copies/106 PBMC during the first year was followed by a milder decrease of < 0.2 log10 copies/106 PBMC per year during the 2nd and 3rd years, without any further diminution afterwards. Maintenance of therapy beyond 3 years is necessary to avoid the replenishment of the compartment of cells actively producing virus, but any additional benefit in terms of reduction of the viral reservoir seems highly unlikely.

As previously shown [16], there was only a very slight gain in CD4 cells after 18 months of treatment. Interestingly, the absolute increase in the CD4 cell count was not different in the patients with CD4 baseline values below or above the median value of the population, and there was no marked further benefit in the long term in either group, but the level of the CD4 curve was different. The majority of patients had reached a CD4 cell count constantly ≥ 400 × 106/l by month 30, and nearly all of those with a baseline CD4 cell count above the median (135 × 106/l) had attained that level at the end of follow-up. For patients who have reached this level of CD4 cell counts, a reasonably safe level both for the protection against opportunistic infections and for considering treatment interruption, the immunological benefit of maintaining HAART appears debatable.

It is more and more difficult to imagine anti-HIV treatments as life-long prescriptions, given the side effects described in the long term, such as lipodystrophy (found here in nearly 60% of patients), metabolic disturbances, a possibly increased cardiovascular risk, mitochondrial toxicity and altered quality of life. In other words, the inconvenience of a very-long-term treatment may outweigh the benefit of maintaining the CD4 cell count at a high level, considering that treatment beyond 2 to 4 years will not result in a significant further reduction of the HIV-1 DNA load. For patients with high CD4 cell values (e.g. > 400 × 106/l) after this time on HAART, would it be reasonable to consider stopping therapy when the level of HIV-1 DNA reaches its lowest plateau and then wait for the patients to meet again the criteria for treatment initiation? Trials should be designed to compare this long-term strategy of prolonged periods on and off therapy with the standard attitude of maintaining HAART and with structured treatment interruptions with a shorter time scale.

In summary, the data presented here show that HIV-1 DNA does not seem influenced by HAART after the third year and confirm that the CD4 cell count gain is less apparent after 18 months on treatment. Based on these observations, we question the benefits of a life-long treatment for HIV infection.

Back to Top | Article Outline

Acknowledgements

We thank the patients for their participation in the study and the HIV quantification group (AC11) of the ANRS.

Back to Top | Article Outline

References

1. Blankson JN, Persaud D, Siliciano R. The challenge of viral reservoirs in HIV-1 infection. Annu Rev Med 2002, 53:557–593.

2. Furtado MR, Callaway DS, Phair JP, Kunstman KJ, Stanton JL, Macken CA, et al. Persistence of HIV-1 transcription in peripheral blood mononuclear cells in patients receiving potent antiretroviral therapy. N Engl J Med 1999, 340:1614–1622.

3. Kaufmann R, Bloch M, Zaunders JJ, Smith D, Cooper DA. Long-term immunological response in HIV-1–infected subjects receiving potent antiretroviral therapy. AIDS 2000; 14:959–969.

4. Burgard M, Chaix ML, Ngo N, Leruez M, Rouzioux C, and the French Perinatal HIV Infection Study Group. Real-time HIV-1 PCR for the diagnosis of infection in newborn of African mothers. Eighth Conference on Retroviruses and Opportunistic Infections. Chicago, February 2001 [abstract 243].

5. Diggle PJ, Liang KY, Zeger SL. Fitting smooth curves to longitudinal data. In Analysis of Longitudinal Data. Edited by Atkinson AC, Copas JB, Pierce DA, Schervish MJ, Titterington DM. Oxford: Oxford University Press; 1994:41–47.

6. Izopet J, Salama G, Pasquier C, Sandres K, Marchou B, Massip P, et al. Decay of HIV-1 DNA in patients receiving suppressive antiretroviral therapy. J Acquir Immune Defic Syndr Hum Retrovirol 1998, 19:478–483.

7. Burgard M, Izopet J, Dumon B, Tamalet C, Descamps D, Ruffault A, et al. HIV RNA and HIV DNA in peripheral blood mononuclear cells are consistent markers for estimating viral load in patients undergoing long-term potent treatment. AIDS Res Hum Retroviruses 2000, 16:1939–1947.

8. Saitoh A, Hsia K, Fenton T, Powell CA, Christopherson C, Fletcher CV, et al. Persistence of human immunodeficiency virus (HIV) type 1 DNA in peripheral blood despite prolonged suppression of plasma HIV-1 RNA in children. J Infect Dis 2002, 185: 1409–1416.

9. Ngo-Giang-Huong N, Deveau C, Da Silva I, Pellegrin I, Venet A, Harzic M, et al. Proviral HIV-1 DNA in subjects followed since primary infection who suppress plasma viral load after one year of highly active antiretroviral therapy. AIDS 2001, 15:665–673.

10. Garrigue I, Pellegrin I, Hoen B, Dumon B, Harzic M, Schrive MH, et al. Cell-associated HIV-1 DNA quantitation after HAART-treated primary infection in patients with persistently undetectable plasma HIV-1 RNA. AIDS 2000, 14:2851–2856.

11. Emilie D, Burgard M, Lascoux-Combe C, Laughlin M, Krzysiek R, Pignon C, et al. Early control of HIV replication in primary HIV-1 infection treated with antiretroviral drugs and pegylated IFNγ: results from the Primoferon (ANRS 086) Study. AIDS 2001, 15: 1435–1437.

12. Yerly S, Perneger TV, Vora S, Hirschel B, Perrin L. Decay of cell-associated HIV-1 DNA correlates with residual replication in patients treated during acute HIV-1 infection. AIDS 2000, 14: 2805–2812.

13. Jubault V, Burgard M, Le Corfec E, Costagliola D, Rouzioux C, Viard JP. High rebound of plasma and cellular HIV load after discontinuation of triple combination therapy. AIDS 1998, 12:2358–2359.

14. Rouzioux C. Early HIV-1 DNA level predicts disease progression and death independently of HIV-RNA level and CD4 count. First International AIDS Society Conference on HIV Pathogenesis and Treatment. Buenos Aires, July 2001[abstract A23].

15. Kostrikis LG, Touloumi G, Karanicolas R, Pantazis N, Anastassopoulou C, Karafoulidou A, et al. Quantitation of human immunodeficiency virus type 1 DNA forms with the second template switch in pripheral blood cells predicts disease progression independently of plasma RNA load. J Virol 2002; 76: 10099–10108.

16. Tarwater PM, Margolick JB, Jin J, Phair JP, Detels R, Rinaldo C, et al. Increase and plateau of CD4 T-cell counts in the 3½ years after initiation of potent antiretroviral therapy. J Acquir Immune Defic Syndr 2001, 27:168–175.

Cited By:

This article has been cited 69 time(s).

Plos One
Inhibition of Dual/Mixed Tropic HIV-1 Isolates by CCR5-Inhibitors in Primary Lymphocytes and Macrophages
Surdo, M; Balestra, E; Saccomandi, P; Di Santo, F; Montano, M; Di Carlo, D; Sarmati, L; Aquaro, S; Andreoni, M; Svicher, V; Perno, CF; Ceccherini-Silberstein, F
Plos One, 8(7): -.
ARTN e68076
CrossRef
Plos One
Effect of Genital Herpes on Cervicovaginal HIV Shedding in Women Co-Infected with HIV AND HSV-2 in Tanzania
Todd, J; Riedner, G; Maboko, L; Hoelscher, M; Weiss, HA; Lyamuya, E; Mabey, D; Rusizoka, M; Belec, L; Hayes, R
Plos One, 8(3): -.
ARTN e59037
CrossRef
Hiv Medicine
Ageing and long-term CD4 cell count trends in HIV-positive patients with 5 years or more combination antiretroviral therapy experience
Wright, ST; Petoumenos, K; Boyd, M; Carr, A; Downing, S; O'Connor, CC; Grotowski, M; Law, MG
Hiv Medicine, 14(4): 208-216.
10.1111/j.1468-1293.2012.01053.x
CrossRef
Hiv Clinical Trials
Dynamics of Cellular HIV-1 DNA Levels Over 144 Weeks of Darunavir/Ritonavir Monotherapy Versus Triple Therapy in the MONET Trial
Geretti, AM; Arribas, JR; Lathouwers, E; Foster, GM; Yakoob, R; Kinloch, S; Hill, A; van Delft, Y; Moecklinghoff, C
Hiv Clinical Trials, 14(1): 45-50.
10.1410/hct1401-45
CrossRef
Journal of Antimicrobial Chemotherapy
Long-term antiretroviral therapy initiated during primary HIV-1 infection is key to achieving both low HIV reservoirs and normal T cell counts
Hocqueloux, L; Avettand-Fenoel, V; Jacquot, S; Prazuck, T; Legac, E; Melard, A; Niang, M; Mille, C; Le Moal, G; Viard, JP; Rouzioux, C
Journal of Antimicrobial Chemotherapy, 68(5): 1169-1178.
10.1093/jac/dks533
CrossRef
Clinical Infectious Diseases
CD4(+) cell count 6 years after commencement of highly active antiretroviral therapy in persons with sustained virologic suppression
Moore, RD; Keruly, JC
Clinical Infectious Diseases, 44(3): 441-446.

Clinical Infectious Diseases
Predictors of virological outcome and safety in primary HIV type 1-infected patients initiating quadruple antiretroviral therapy: QUEST GW PROB3005
Hoen, B; Cooper, DA; Lampe, FC; Perrin, L; Clumeck, N; Phillips, AN; Goh, LE; Lindback, S; Sereni, D; Gazzard, B; Montaner, J; Stellbrink, HJ; Lazzarin, A; Ponscarme, D; Staszewski, S; Mathiesen, L; Smith, D; Finlayson, R; Weber, R; Wegmann, L; Janossy, G; Kinloch-de Loes, S
Clinical Infectious Diseases, 45(3): 381-390.
10.1086/519428
CrossRef
Scandinavian Journal of Immunology
HIV-infected Patients with a Large Thymus Maintain Higher CD4 Counts in a 5-year Follow-up Study of Patients Treated with Highly Active Antiretroviral Therapy
Kolte, L; Ryder, LP; Albrecht-Beste, E; Jensen, FK; Nielsen, SD
Scandinavian Journal of Immunology, 70(6): 608-613.
10.1111/j.1365-3083.2009.02328.x
CrossRef
Journal of Virological Methods
Comparison of real-time PCR methods for measurement of HIV-1 proviral DNA
Rozera, G; Abbate, I; Bruselles, A; Bartolini, B; D'Offizi, G; Nicastri, E; Tommasi, C; Capobianchi, MR
Journal of Virological Methods, 164(): 135-138.
10.1016/j.jviromet.2009.11.031
CrossRef
Experimental Biology and Medicine
The HIV-1 Tat protein enhances megakaryocytic commitment of K562 cells by facilitating CREB transcription factor coactivation by CBP
Williams, CA; Mondal, D; Agrawal, KC
Experimental Biology and Medicine, 230(): 872-884.

AIDS Research and Human Retroviruses
Profile of immunologic recovery in HIV-infected Ugandan adults after antiretroviral therapy
Baker, CAR; Emenyonu, N; Ssewanyana, I; Jones, NG; Elrefaei, M; Nghania, F; Nakiwala, J; Andia, I; Clark, R; Martin, J; Bangsberg, DR; Cao, HY
AIDS Research and Human Retroviruses, 23(7): 900-905.
10.1089/aid.2006.0309
CrossRef
Journal of Infectious Diseases
Early levels of HIV-1 DNA in peripheral blood mononuclear cells are predictive of disease progression independently of HIV-1 RNA levels and CD4(+) T cell counts
Rouzioux, C; Hubert, JB; Burgard, M; Deveau, C; Goujard, C; Bary, M; Sereni, D; Viard, JP; Delfraissy, JF; Meyer, L
Journal of Infectious Diseases, 192(1): 46-55.

Lancet
Effect of co-trimoxazole prophylaxis, antiretroviral therapy, and insecticide-treated bednets on the frequency of malaria in HIV-1-infected adults in Uganda: a prospective cohort study
Mermin, J; Ekwaru, JP; Liechty, CA; Were, W; Downing, R; Ransom, R; Weidle, P; Lule, J; Coutinho, A; Solberg, P
Lancet, 367(): 1256-1261.

Current Hiv Research
HIV-1 residual viremia and proviral DNA in patients with suppressed plasma viral load (< 400 HIV-RNA cp/ml) during different antiretroviral regimens
Nicastri, E; Palmisano, L; Sarmati, L; D'Ettorre, G; Parisi, S; Andreotti, M; Buonomini, A; Pirillo, FM; Narciso, P; Bellagamba, R; Vullo, V; Montano, M; Di Perri, G; Andreoni, M
Current Hiv Research, 6(3): 261-266.

Hiv Medicine
Viral efficacy maintained and safety parameters improved with a reduced dose of stavudine: a pilot study
Ait-Mohand, H; Bonmarchand, M; Guiguet, M; Slama, L; Marguet, F; Behin, A; Amellal, B; Bennai, Y; Peytavin, G; Calvez, V; Pialoux, G; Murphy, R; Katlama, C
Hiv Medicine, 9(9): 738-746.
10.1111/j.1468-1293.2008.00616.x
CrossRef
AIDS
Is the male genital tract really a sanctuary site for HIV? Arguments that it is not
Lowe, SH; Sankatsing, SUC; Repping, S; van der Veen, F; Reiss, P; Lange, JMA; Prins, JM
AIDS, 18(): 1353-1362.
10.1097/01.aids.0000125979.64033.96
CrossRef
Clinical Infectious Diseases
Factors Associated with Mother-to-Child Transmission of HIV-1 Despite a Maternal Viral Load < 500 Copies/mL at Delivery: A Case-Control Study Nested in the French Perinatal Cohort (EPF-ANRS CO1)
Tubiana, R; Le Chenadec, J; Rouzioux, C; Mandelbrot, L; Hamrene, K; Dollfus, C; Faye, A; Delaugerre, C; Blanche, S; Warszawski, J
Clinical Infectious Diseases, 50(4): 585-596.
10.1086/650005
CrossRef
Molecular and Cellular Probes
Fast and sensitive quantitative detection of HIV DNA in whole blood leucocytes by SYBR green I real-time PCR assay
Casabianca, A; Gori, C; Chiara, OA; Forbici, F; Perno, CF; Maanani, M
Molecular and Cellular Probes, 21(): 368-378.
10.1016/j.mcp.2007.05.005
CrossRef
New Microbiologica
The role of HIV-DNA testing in clinical practice
d'Ettorre, G; Zaffiri, L; Ceccarelli, G; Mastroianni, CM; Vullo, V
New Microbiologica, 33(1): 1-11.

Journal of Antimicrobial Chemotherapy
Impact of 48 week lopinavir/ritonavir monotherapy on blood cell-associated HIV-1-DNA in the MONARK trial
Avettand-Fenoel, V; Flandre, P; Chaix, ML; Ghosn, J; Delaugerre, C; Raffi, F; NgoVan, P; Cohen-Codar, I; Delfraissy, JF; Rouzioux, C
Journal of Antimicrobial Chemotherapy, 65(5): 1005-1007.
10.1093/jac/dkq084
CrossRef
Journal of Infectious Diseases
Treatment of acute HIV-1 infection: Is it coming of age?
Kinloch-de Loes, S
Journal of Infectious Diseases, 194(6): 721-724.

Antiviral Therapy
CD4(+) T-cell count increase in HIV-1-infected patients with suppressed viral load within 1 year after start of antiretroviral therapy
Wolbers, M; Battegay, M; Hirschel, B; Furrer, H; Cavassini, M; Hasse, B; Vernazza, PL; Bernasconi, E; Kaufmann, G; Bucher, HC
Antiviral Therapy, 12(6): 889-897.

Journal of Infectious Diseases
Dynamics of total, linear nonintegrated, and integrated HIV-1 DNA in vivo and in vitro
Koelsch, KK; Liu, L; Haubrich, R; May, S; Havlir, D; Gunthard, HF; Ignacio, CC; Campos-Soto, P; Little, SJ; Shafer, R; Robbins, GK; D'Aquila, RT; Kawano, Y; Young, K; Dao, P; Spina, CA; Richman, DD; Wong, JK
Journal of Infectious Diseases, 197(3): 411-419.
10.1086/525283
CrossRef
AIDS
Residual viraemia in subjects with chronic HIV infection and viral load < 50 copies/ml: the impact of highly active antiretroviral therapy
Palmisano, L; Giuliano, M; Nicastri, E; Pirillo, MF; Andreotti, M; Galluzzo, CM; Bucciardini, R; Fragola, V; Andreoni, M; Vella, S
AIDS, 19(): 1843-1847.

Hiv Clinical Trials
Simplified maintenance therapy with abacavir/lamivudine/zidovudine plus tenofovir after sustained HIV load suppression: Four years of follow-up
d'Ettorre, G; Zaffiri, L; Ceccarelli, G; Andreotti, M; Massetti, AP; Vella, S; Mastroianni, CM; Vullo, V
Hiv Clinical Trials, 8(3): 182-188.
10.1310/hct0803-182
CrossRef
Kidney International
HIV-related nephropathies associated with changes in blood and kidney tissue virus load
Audard, V; Avouac, J; Wirden, M; Pardon, A; Matignon, M; Remy, P; Desvaux, D; Lang, P; Grimbert, P
Kidney International, 73(5): 651-655.
10.1038/sj.ki.5002765
CrossRef
AIDS Research and Human Retroviruses
Predictive Value of Intracellular HIV-1 DNA Levels During CD4-Guided Treatment Interruption in HIV+ Patients
Nasi, M; Pinti, M; Manzini, S; Gibellini, L; Manzini, L; Bisi, L; De Biasi, S; Del Giovane, C; D'Amico, R; Borghi, V; Mussini, C; Cossarizza, A
AIDS Research and Human Retroviruses, 26(5): 553-558.
10.1089/aid.2009.0256
CrossRef
Clinical Infectious Diseases
HIV controllers: A homogeneous group of HIV-1-infected patients with spontaneous control of viral replication
Lambotte, O; Boufassa, F; Madec, Y; Nguyen, A; Goujard, C; Meyer, L; Rouzioux, C; Venet, A; Delfraissy, JF
Clinical Infectious Diseases, 41(7): 1053-1056.

Hiv Medicine
Long-term evolution of CD4 count in patients with a plasma HIV RNA persistently < 500 copies/mL during treatment with antiretroviral drugs
Le Moing, V; Thiebaut, R; Chene, G; Sobel, A; Massip, P; Collin, F; Meyohas, MC; Al Kaied, F; Leport, C; Raffi, F
Hiv Medicine, 8(3): 156-163.

Journal of Clinical Microbiology
Real-time PCR quantification of genital shedding of herpes simplex virus (HSV) and human immunodeficiency virus (HIV) in women coinfected with HSV and HIV
Legoff, J; Bouhlal, H; Gresenguet, G; Weiss, H; Khonde, N; Hocini, H; Desire, N; Si-Mohamed, A; Longo, JD; Chemin, C; Frost, E; Pepin, J; Malkin, JE; Mayaud, P; Belec, L
Journal of Clinical Microbiology, 44(2): 423-432.
10.1128/JCM.44.2.423-432.2006
CrossRef
AIDS Reviews
Elite HIV controllers: Myth or reality?
Saksena, NK; Rodes, B; Wang, B; Soriano, V
AIDS Reviews, 9(4): 195-207.

Journal of Clinical Microbiology
Association between cellular human immunodeficiency virus DNA level and immunological parameters in patients with undetectable plasma viremia level during highly active antiretroviral therapy
Sarmati, L; Parisi, SG; Nicastri, E; d'Ettorre, G; Palmisano, L; Andreotti, M; Andreoni, C; Giuliano, M; Gatti, F; Boldrin, C; Palu, G; Vullo, V; Vella, S; Andreoni, M
Journal of Clinical Microbiology, 43(): 6183-6185.
10.1128/JCM.43.12.6183-6185.2005
CrossRef
Current Hiv Research
The Role of HIV-1 DNA as an Additional Marker of HIV-1 Infection
Beloukas, A; Paraskevis, D; Psichogiou, M; Hatzakis, A
Current Hiv Research, 7(3): 255-265.

AIDS Research and Human Retroviruses
Predictive Value of HIV Type 1 DNA Levels on Overall Survival in HIV-Related Lymphoma Patients Treated with High-Dose Chemotherapy (HDC) Plus Autologous Stem Cell Transplantation (ASCT)
Bortolin, MT; Zanussi, S; Talamini, R; Simonelli, C; Pratesi, C; Tedeschi, R; Abbruzzese, L; Manuele, R; Rupolo, M; Tirelli, U; De Paoli, P
AIDS Research and Human Retroviruses, 26(2): 245-251.
10.1089/aid.2009.0081
CrossRef
Plos Pathogens
HIV Controller CD4+T Cells Respond to Minimal Amounts of Gag Antigen Due to High TCR Avidity
Vingert, B; Perez-Patrigeon, S; Jeannin, P; Lambotte, O; Boufassa, F; Lemaitre, F; Kwok, WW; Theodorou, I; Delfraissy, JF; Theze, J; Chakrabarti, LA
Plos Pathogens, 6(2): -.
ARTN e1000780
CrossRef
Clinical Infectious Diseases
Virological control during the first 6-18 months after initiating highly active antiretroviral therapy as a predictor for outcome in HIV-infected patients: A Danish, population-based, 6-year follow-up study
Lohse, N; Kronborg, G; Gerstoft, J; Larsen, CS; Pedersen, G; Pedersen, C; Sorensen, HT; Obel, N
Clinical Infectious Diseases, 42(1): 136-144.

Journal of Medical Virology
Cellular HIV-1 DNA quantitation in patients during simplification therapy with protease inhibitor-sparing regimens
Sarmati, L; Parisi, SG; Nicastri, E; d'Ettorre, G; Andreoni, C; Dori, L; Gatti, F; Montano, M; Buonomini, AR; Boldrin, C; Palu, G; Vullo, V; Andreoni, M
Journal of Medical Virology, 79(7): 880-886.
10.1002/jmv.20914
CrossRef
AIDS
Greater viral rebound and reduced time to resume antiretroviral therapy after therapeutic immunization with the ALVAC-HIV vaccine (vCP1452)
Autran, B; Murphy, RL; Costagliola, D; Tubiana, R; Clotet, B; Gatell, J; Staszewski, S; Wincker, N; Assoumou, L; El-Habib, R; Calvez, V; Walker, B; Katlama, C
AIDS, 22(): 1313-1322.

Fems Immunology and Medical Microbiology
Changes in T-cell subpopulations during four years of suppression of HIV-1 replication in patients with advanced disease
Lepej, SZ; Begovac, J; Vince, A
Fems Immunology and Medical Microbiology, 46(3): 351-359.
10.1111/j.1574-695X.2005.00034.x
CrossRef
Revista De Nefrologia Dialisis Y Trasplante
Glomerulopathies found in HIV plus patients: Case reports of a Public Hospital in Buenos Aires city - Argentina
Petrolito, J; Di Tullio, D; Schiavelli, R; Chanta, G; Kidd, S; Mera, V; Kozima, S; Larranaga, N
Revista De Nefrologia Dialisis Y Trasplante, 29(3): 115-123.

Clinical Microbiology and Infection
Detection of residual human immunodeficiency virus type 1 reverse transcriptase K103N minority species in plasma RNA and peripheral blood mononuclear cell DNA following discontinuation of non-nucleoside therapy
Saladini, F; Vicenti, I; Razzolini, F; Zazzi, M
Clinical Microbiology and Infection, 16(7): 848-851.
10.1111/j.1469-0691.2009.03005.x
CrossRef
Intervirology
Evaluation of a 6-Year Highly Active Antiretroviral Therapy in Chinese HIV-1-Infected Patients
Zhou, HY; Zheng, YH; He, Y; Chen, Z; Liu, M; Yin, W; Liu, C
Intervirology, 53(4): 240-246.
10.1159/000302762
CrossRef
AIDS
Prolonged valproic acid treatment does not reduce the size of latent HIV reservoir
Sagot-Lerolle, N; Lamine, A; Chaix, ML; Boufassa, F; Aboulker, JP; Costagliola, D; Goujard, C; Paller, C; Delfraissy, JF; Lambotte, O
AIDS, 22(): 1125-1129.

Journal of Medical Virology
Prognostic Factors of Long-Term CD4+Count-Guided Interruption of Antiretroviral Treatment
Sarmati, L; Andreoni, C; Nicastri, E; Tommasi, C; Buonomini, A; D'Ettorre, G; Corpolongo, A; Dori, L; Montano, M; Volpi, A; Narciso, P; Vullo, V; Andreoni, M
Journal of Medical Virology, 81(3): 481-487.
10.1002/jmv.21424
CrossRef
Plos One
Distinct Genetic Loci Control Plasma HIV-RNA and Cellular HIV-DNA Levels in HIV-1 Infection: The ANRS Genome Wide Association 01 Study
Dalmasso, C; Carpentier, W; Meyer, L; Rouzioux, C; Goujard, C; Chaix, ML; Lambotte, O; Avettand-Fenoel, V; Le Clerc, S; de Senneville, LD; Deveau, C; Boufassa, F; Debre, P; Delfraissy, JF; Broet, P; Theodorou, I
Plos One, 3(): -.
ARTN e3907
CrossRef
Microbiologica
Clinical pharmacology of antiretroviral therapy
Di Perri, G; Sinicco, A; Audagnotto, S; Gobbi, F; Canta, F; Marrone, R; Bonora, S
Microbiologica, 27(2): 131-134.

Netherlands Journal of Medicine
Antiretroviral therapy adults infected in previously untreated with the human immunodeficiency virus type I: established and potential determinants of virological outcome
Lowe, SH; Prins, JM; Lange, JMA
Netherlands Journal of Medicine, 62(): 424-440.

Journal of Clinical Virology
HIV-1 DNA for the measurement of the HIV reservoir is predictive of disease progression in seroconverters whatever the mode of result expression is
Avettand-Fenoel, V; Boufassa, F; Galimand, J; Meyer, L; Rouzioux, C
Journal of Clinical Virology, 42(4): 399-404.
10.1016/j.jcv.2008.03.013
CrossRef
Plos One
Cellular HIV-1 DNA Levels in Drug Sensitive Strains Are Equivalent to Those in Drug Resistant Strains in Newly-Diagnosed Patients in Europe
Demetriou, VL; van de Vijver, DAMC; Kousiappa, I; Balotta, C; Clotet, B; Grossman, Z; Jorgensen, LB; Lepej, SZ; Levy, I; Nielsen, C; Paraskevis, D; Poljak, M; Roman, F; Ruiz, L; Schmidt, JC; Vandamme, AM; Van Laethem, K; Vercauteren, J; Kostrikis, LG
Plos One, 5(6): -.
ARTN e10976
CrossRef
Antiviral Therapy
Predicting the magnitude of short-term CD4(+) T-cell recovery in HIV-infected patients during first-line highly active antiretroviral therapy
Castagna, A; Galli, L; Torti, C; Monforte, AD; Mussini, C; Antinori, A; Cozzi-Lepri, A; Ladisa, N; De Luca, A; Seminari, E; Gianotti, N; Lazzarin, A
Antiviral Therapy, 15(2): 165-175.
10.3851/IMP1513
CrossRef
Pediatrics
Coercive treatment of HIV-positive children is not justified
Crowe, D; De Matteo, D; Irwin, M; Kent, G; McClain, V
Pediatrics, 116(6): 1605-1606.
10.1542/peds.2005-0018
CrossRef
Virology
A more precise HIV integration assay designed to detect small differences finds lower levels of integrated DNA in HAART treated patients
Yu, JJQ; Wu, TL; Liszewski, MK; Dai, JH; Swiggard, WJ; Baytop, C; Frank, I; Levine, BL; Yang, W; Theodosopoulos, T; O'Doherty, U
Virology, 379(1): 78-86.
10.1016/j.virol.2008.05.030
CrossRef
AIDS Research and Human Retroviruses
Use of Massive Parallel Pyrosequencing for Near Full-Length Characterization of a Unique HIV Type 1 BF Recombinant Associated with a Fatal Primary Infection
Bruselles, A; Rozera, G; Bartolini, B; Prosperi, M; Del Nonno, F; Narciso, P; Capobianchi, MR; Abbate, I
AIDS Research and Human Retroviruses, 25(9): 937-942.
10.1089/aid.2009.0083
CrossRef
AIDS
Differences in proviral DNA load between HIV-1- and HIV-2-infected patients
Plantier, J; Chêne, G; Matheron, S; Brun-Vézinet, F; Simon, F; Gueudin, M; Damond, F; Braun, J; Taïeb, A; Lemée, V
AIDS, 22(2): 211-215.
10.1097/QAD.0b013e3282f42429
PDF (106) | CrossRef
AIDS
Mother-to-child HIV transmission despite antiretroviral therapy in the ANRS French Perinatal Cohort
for the ANRS French Perinatal Cohort, ; Warszawski, J; Tubiana, R; Le Chenadec, J; Blanche, S; Teglas, J; Dollfus, C; Faye, A; Burgard, M; Rouzioux, C; Mandelbrot, L
AIDS, 22(2): 289-299.
10.1097/QAD.0b013e3282f3d63c
PDF (164) | CrossRef
AIDS
Immune and virological benefits of 10 years of permanent viral control with antiretroviral therapy
Guihot, A; Tubiana, R; Breton, G; Marcelin, A; Samri, A; Assoumou, L; Goncalves, E; Bricaire, F; Costagliola, D; Calvez, V; Rouzioux, C; Autran, B; Katlama, C; Carcelain, G; ALT-ANRS CO-15 study group; DECAMUNE study group,
AIDS, 24(4): 614-617.
10.1097/QAD.0b013e32833556f3
PDF (6618) | CrossRef
AIDS
Failure of bone marrow transplantation to eradicate HIV reservoir despite efficient HAART
Cavazzana-Calvo, M; Rouzioux, C; Blanche, S; Avettand-Fenoel, V; Mahlaoui, N; Chaix, M; Milliancourt, C; Burgard, M
AIDS, 21(6): 776-777.
10.1097/QAD.0b013e3280b01836
PDF (349) | CrossRef
AIDS
Decrease of Lewis frequency in HIV-infected patients: possible competition of fucosylated antigens with HIV for binding to DC-SIGN
Izopet, J; Blancher, A; Puissant, B; Roubinet, F; Dellacasagrande, J; Massip, P; Abbal, M; Pasquier, C
AIDS, 19(6): 627-630.

PDF (130)
AIDS
Twin pregnancy as a risk factor for mother-to-child transmission of HIV-1: trends over 20 years
ANRS EPF, ; Scavalli, CP; Mandelbrot, L; Berrebi, A; Batallan, A; Cravello, L; Pannier, E; Hamrene, K; Ciraru-Vigneron, N; Faye, A; Warszawski, J
AIDS, 21(8): 993-1002.
10.1097/QAD.0b013e3281532b19
PDF (161) | CrossRef
AIDS
No detection of HIV 1-RNA in semen of men on efficient HAART in the past 4 years of a 2002–2009 survey
Dulioust, E; Leruez-Ville, M; Guibert, J; Fubini, A; Jegou, D; Launay, O; Sogni, P; Jouannet, P; Rouzioux, C
AIDS, 24(10): 1595-1598.
10.1097/QAD.0b013e32833b47fc
PDF (320) | CrossRef
AIDS
Long-term immunovirologic control following antiretroviral therapy interruption in patients treated at the time of primary HIV-1 infection
Hocqueloux, L; Prazuck, T; Avettand-Fenoel, V; Lafeuillade, A; Cardon, B; Viard, J; Rouzioux, C
AIDS, 24(10): 1598-1601.
10.1097/QAD.0b013e32833b61ba
PDF (320) | CrossRef
AIDS
Hepatitis B and long-term HIV outcomes in coinfected HAART recipients
Hoffmann, CJ; Seaberg, EC; Young, S; Witt, MD; D'Acunto, K; Phair, J; Thio, CL
AIDS, 23(14): 1881-1889.
10.1097/QAD.0b013e32832e463a
PDF (462) | CrossRef
AIDS
Factors influencing peripheral blood mononuclear cell-associated HIV-1 DNA level after long-term suppressive antiretroviral therapy in 236 patients
Burgard, M; Boufassa, F; Viard, J; Garrigue, I; Ruffault, A; Izopet, J; Vabret, A; Descamps, D; Colson, P; Seigneurin, J; Rouzioux, C; for the ANRS AC11 Working Group,
AIDS, 23(16): 2165-2171.
10.1097/QAD.0b013e32833032d4
PDF (320) | CrossRef
JAIDS Journal of Acquired Immune Deficiency Syndromes
HIV-1 Can Persist in Aged Memory CD4+ T Lymphocytes With Minimal Signs of Evolution After 8.3 Years of Effective Highly Active Antiretroviral Therapy
Nottet, HS; van Dijk, SJ; Fanoy, EB; Goedegebuure, IW; de Jong, D; Vrisekoop, N; Baarle, Dv; Boltz, V; Palmer, S; Borleffs, JC; Boucher, CA
JAIDS Journal of Acquired Immune Deficiency Syndromes, 50(4): 345-353.
10.1097/QAI.0b013e318197eb04
PDF (219) | CrossRef
JAIDS Journal of Acquired Immune Deficiency Syndromes
Long-Term Patterns in CD4 Response Are Determined by an Interaction Between Baseline CD4 Cell Count, Viral Load, and Time: The Asia Pacific HIV Observational Database (APHOD)
Egger, S; Petoumenos, K; Kamarulzaman, A; Hoy, J; Sungkanuparph, S; Chuah, J; Falster, K; Zhou, J; Law, MG; on behalf of the Asia Pacific HIV Observational Database (APHOD),
JAIDS Journal of Acquired Immune Deficiency Syndromes, 50(5): 513-520.
10.1097/QAI.0b013e31819906d3
PDF (273) | CrossRef
JAIDS Journal of Acquired Immune Deficiency Syndromes
In Untreated HIV-1–Infected Children, PBMC-Associated HIV DNA Levels and Cell-Free HIV RNA Levels Are Correlated to Distinct T-lymphocyte Populations
Scott-Algara, D; Rouzioux, C; Blanche, S; Burgard, M; Didier, C; Rivière, Y; Buseyne, F
JAIDS Journal of Acquired Immune Deficiency Syndromes, 53(5): 553-563.
10.1097/QAI.0b013e3181cf060f
PDF (676) | CrossRef
JAIDS Journal of Acquired Immune Deficiency Syndromes
Long-Term CD4+ T-Cell Response to Highly Active Antiretroviral Therapy According to Baseline CD4+ T-Cell Count
García, F; de Lazzari, E; Plana, M; Castro, P; Mestre, G; Nomdedeu, M; Fumero, E; Martínez, E; Mallolas, J; Blanco, JL; Miró, JM; Pumarola, T; Gallart, T; Gatell, JM
JAIDS Journal of Acquired Immune Deficiency Syndromes, 36(2): 702-713.

PDF (645)
JAIDS Journal of Acquired Immune Deficiency Syndromes
Structured Treatment Interruptions in Primary HIV-1 Infection: The ANRS 100 PRIMSTOP Trial
Hoen, B; Fournier, I; Lacabaratz, C; Burgard, M; Charreau, I; Chaix, M; Molina, J; Livrozet, J; Venet, A; Raffi, F; Aboulker, J; Rouzioux, C; for the PRIMSTOP Study Group,
JAIDS Journal of Acquired Immune Deficiency Syndromes, 40(3): 307-316.

PDF (677)
JAIDS Journal of Acquired Immune Deficiency Syndromes
Changes in the Slope of the CD4 Cell Count Increase After Initiation of Potent Antiretroviral Treatment
Bosch, RJ; Wang, R; Vaida, F; Lederman, MM; Albrecht, MA; for the AIDS Clinical Trial Group 364 Study Team,
JAIDS Journal of Acquired Immune Deficiency Syndromes, 43(4): 433-435.
10.1097/01.qai.0000243097.27029.b7
PDF (97) | CrossRef
Back to Top | Article Outline
Keywords:

HIV-1 infection; CD4 cells; plasma HIV-1 RNA; HIV-1 DNA; highly active antiretroviral therapy

© 2004 Lippincott Williams & Wilkins, Inc.

Login

Search for Similar Articles
You may search for similar articles that contain these same keywords or you may modify the keyword list to augment your search.