Skip Navigation LinksHome > May 2, 2003 - Volume 17 - Issue 7 > Primary resistance mutations to fusion inhibitors and polymo...
AIDS:
Research Letters

Primary resistance mutations to fusion inhibitors and polymorphisms in gp41 sequences of HIV-1 non-B subtypes and recombinants

Villahermosa, Maria La; Perez-Alvarez, Luciaa; Carmona, Rocioa; Cuevas, Maria Ta; Thomson, Migue Ma; Medrano, Leandroa; Parga, Elena Vazquezdea; Delgado, Elena; Pedreira, José Domingob; Nájera, Rafaela

Free Access
Article Outline
Collapse Box

Author Information

aInstituto de Salud Carlos III, Patogenia Viral, Majadahonda, Madrid, Spain; and bHospital Juan Canalejo, La Coruña, Spain.

Sponsorship: This work was partly funded by grants SBVI 1001/01/1 and SLVI-1435/01-1 from Plan Nacional del SIDA, Ministerio de Sanidad y Consumo, Spain, and by scientific agreement with the Government of Galicia, Xunta de Galicia, Spain.

Received: 6 August 2002; revised: 3 October 2002; accepted: 15 October 2002.

Primary resistance mutations to fusion inhibitors and polymorphisms in gp41 sequences of non-B subtypes and recombinant HIV-1 isolates were analysed. L91H to RPR103611 was detected in one DGpol/Denv/Dgp41 recombinant; L9F and K144R, rarely reported previously, were frequent in the B region of CRF14_BG recombinants. V194I and V318A, not described in the G subtype, were detected in the G region of BG recombinants and in G subtype viruses that also show the rare mutations T115L, M118V and K90R.

Genetic diversity within the gp41 gene and its immunodominant regions should have possible functional influences. Gp41 has many functional domains, including the immunodominant region in the aminoterminal portion [1], which contains a cytotoxic T lymphocyte (CTL) epitope (amino acids 591–602), the cysteine loop (aa 607–613), which is the most immunogenic region of gp41, and the ectodomain (aa 671–676). Some 99% of HIV-1-infected patients produce antibodies against these targets [1–3].

HIV-1 gp41 envelope protein mediates viral fusion with human host cells. HIV-1 fusion inhibitor T20, which is in phase III clinical trials, represents a new, successful drug for the treatment of HIV infection in preclinical studies. T20 is a peptide that binds to the helical domain target HR-1 (heptad repeat region) near the fusion domain at the amino-(N)-terminus, and consequently inhibits transition to its fusion-active conformation [4], blocking cell fusion and viral entry. In the gp41 sequence, both G36S and V38M resistance-associated mutations against T20 have been described in vitro [5], and I84S and L91H substitutions have been associated with resistance against the non-peptidic compound RPR103611, which is an efficient inhibitor of membrane fusion [6].

These new entry/fusion inhibitors should increase the success rate of salvage therapy for individuals failing highly active antiretroviral therapy (HAART), and should provide combination therapy alternatives for initial therapy in infected patients. Therefore, it will be important to know whether primary resistance to these drugs can be detected in patients before the initiation of treatments with fusion inhibitors.

On the other hand, the frequency of non-B subtypes and recombinant HIV-1 strains is increasing in different countries [7]. In Spain, we have previously described a high genetic diversity in Galicia [8], showing a high prevalence and incidence of non-B subtypes and recombinant forms in native patients [9].

The aim of this study was to analyse the presence of resistance mutations against T20 and RPR103611 fusion inhibitors and the polymorphisms within the gp41 region of non-B subtypes and recombinant forms of HIV-1 in our studies of patients from Galicia (Spain).

We selected 34 patients (74% men and 26% women), infected with different non-B subtypes and recombinants, who were included in a previous epidemiologically designed study. Seventeen out of 34 patients were under HAART and 17 were treatment naive. Transmission was by intravenous drug use in 18 cases (53%), and by heterosexual contact in 16 (47%).

Reverse transcriptase (RT) and protease genes were amplified and sequenced as reported [10], and resistance mutations were defined following the criteria of Stanford HIV RT and Protease Sequence Database (http://hivdb.stanford.edu/hiv/).

The V3 gene was amplified using a nested polymerase chain reaction with primer pairs v3-1s-(position 6557–6582)-(5'–ATGGGATCAAAGCCTAAAGCCATG–3')/v3-2as-(position 7782–7805)-(5'TCCTGCTGCT CCCAAGAACCCAAG–3') as external, and v3-3s-(position 6981–7012)-(5'–CCAGTRGTATCAACTC AACTGCTG–3')/v3-4as-(position 7648–7679)-(5'–TTTATATAATTCACTTCTCCAATT–3') as internal primers. The Gp41 gene was amplified using a nested polymerase chain reaction with primer pairs gp41-1s-(position 7347–7375)-(5'–AGTTTTAATTG TRGAGGRGAATTT–3')/gp41-2as-(position 9436–9457)-(5'–GAAAGTCCCCAGCGGAAAGTCC–3') as external, and gp41-3s-(position 7696–7720)-(5'–TTGAACCAYTAGGAGTAGCACCCA–3')/gp41-4as-(position 9392–9418)-(5'–GTCAGCAGTCCTT GTAGTACTCCGGAT–3') as internal primers. The amplification products were sequenced using Big-Dye Terminator Cycle Sequencing (Applied Biosystems, Perkin Elmer, California, USA) on an automated sequencer (Abi Prism, Applied Biosystems DNA Sequences, Perkin Elmer, California, USA) with primer v3-1s, gp41-3s and gp41-5s-(position 8260–8295)-(5'–TGTGGTATATAAAAATATTCATAA–3'). All the sequences were compared with B and non-B subtype consensus sequences derived from an alignment of all sequences maintained at the Los Alamos HIV Sequence Database. Non-B subtype sequences were examined by neighbouring phylogenetic trees, and intersubtype recombination was analysed by bootscanning using the Simplot program (Ray SC. Simplot for Windows (version 2.5). Distributed by author. http://www.jhu. edu/deptmed/sray/download/Simplot 25.exe.1999).

The different HIV-1 genetic forms (pol/V3/gp41) were two subtype A (6%); three C (9%); two F (6%); three G (9%); seven G/B/BG (CRF-14 BG), 21%; one BG/B/BG, (3%); one BGB/B/B, (3%); one BG/B/B, (3%); one BG/G/G, (3%); one AJU/G/A, (3%); one AJU/G/J, (3%); three AGA/A/AG (CRF-02 AG), (9%); one GUG/U/J (CRF-06), (3%); three GU/A/AG (CRF-02 AG), (9%); one KU/A/A, (3%); one GH/K/K, (3%); one FBF/F/BF (3%) and one DG/D/D (3%).

Resistance mutations to RT or protease inhibitors were detected in 12 of 17 treated patients (70.59%) corresponding to: nucleoside reverse transcriptase inhibitors (NRTI) (two, 16.67%); non-nucleoside reverse transcriptase inhibitors (NNRTI) (two,16.67%); protease inhibitors (PI) (one, 8.30%); both NRTI and NNRTI (three, 25%); NRTI and PI (three, 25%); and to all inhibitors (one, 8.30%).

Resistance mutations to T20 (G36D/S, V38M) or to RPR103611 (I84S, L91H) were not observed in gp41 sequences of any patient. In only one case, (DGpol/Denv/Dgp41 recombinant) was the L91H substitution detected (Table 1). This mutation is located in the ‘loop region’ of gp41, between the proximal and distal helix domains, and it is characteristic of subtype D.

Table 1
Table 1
Image Tools

The results of our study show that primary resistance to fusion inhibitors are a rare event in treated and untreated patients, which is in concordance with a recent study indicating the absence of G36D/S, V38M substitutions in long-term infected and heavily pretreated patients [11]. These findings could indicate the absence of a selective advantage of these variants during the infection or during previous antiretroviral treatment, offering great promise as a new class of antiviral drug.

The analysis of polymorphisms showed different patterns (Table 1): two associated characteristic mutations (L9F and K144R) within the B region of gp41 were observed in a very high frequency (86%) of the recently described CRF14_BG [12]. These mutations are only described in 0.42% (4/946) and 0.21% (2/942), respectively, of B sequences of the Los Alamos Database (http://hiv-web.lanl.gov), which contains a collection of 946 HIV sequences. The L9F change is located in the peptide fusion sequence, and K144R is within the carboxy terminal heptad repeat preceding the transmembrane segment in the ectodomain. We also detected the V194I and V318A associated mutations in 100 and 92%, respectively, in the G region of gp41 sequences corresponding to the CRF14_BG and G subtype viruses. These mutations, located in the transmembrane segment and endodomain, respectively, were not described in any G sequences of the Los Alamos Database.

G subtype sequences showed 75 and 100% of two characteristic mutations, T115L and M118V, which are located between two heptad repeat regions. T115L has been reported in 90% of group O only (14/15 sequences) and SIVcpz (4/5 sequences), and in 3.38% of all sequences of the Los Alamos Database. M118V was reported in 0.42% of the Los Alamos Database.

The K90R substitution, located in the most immunogenic region of gp41 (cysteine loop), was detected in 75% of the G sequences analysed within the gp41 region. K90R is present at a very low frequency in the Los Alamos Database alignments (7.8%). A substitution within the cysteine loop could affect antibody reactivity, as previous reports showed in relation to the substitution L91H [13].

This is the first study in which characteristic mutations in the gp41 sequence of HIV-1 recombinants and non-B subtypes are described. These mutations have been detected specifically in CRF14_BG and G subtype, being in relation to the newly described description of these viruses [14]. These polymorphisms may influence the accessibility of fusion inhibitors to their target sequence, and may have implications in driving complex conformational changes in gp41, affecting the fusion and entry into the cell. The significance of the K90R mutation remains to be determined.

Back to Top | Article Outline

The Spanish Group for Antiretroviral Resistance Studies in Galicia

A. Agulla, A. Mariño, Hospital Arquitecto Marcide, Ferrol (La Coruña); S. López-Calvo, J.D. Pedreira, Hospital Juan Canalejo (La Coruña); A. Aguilera, E. Losada, A. Prieto, Complejo Hospitalario Universitario de Santiago (La Coruña); J. Corredoira, M.J. López-Alvarez, A. Rodríguez, Hospital Xeral-Calde (Lugo); M. Bustillo, J. García-Costa, R. Fernández-Rodríguez, Hospital Nuestra Señora del Cristal (Orense); R. Rodríguez, Hospital Provincial Santa María Madre (Orense); C. Miralles, A. Ocampo, Hospital Xeral-Cíes, Vigo (Pontevedra); R. Ojea de Castro, Hospital Montecelo (Pontevedra); L.E. Morano, R. Pérez-Rodríguez, A. Rodríguez, J. Torres, Hospital Meixoeiro, Vigo (Pontevedra); J. Díz, R. Rodríguez-Real, Hospital Xeral Provincial (Pontevedra).

Back to Top | Article Outline

References

1.Hunter E. Gp41, a multifunctional protein involved in HIV entry and pathogenesis. In: Human retrovirus and AIDS. Korber B, Hahn BH, Foley B, Mellors J, Leitner T, Myers G, et al. (editors). Los Alamos, NM: Los Alamos National Laboratory; 1997. pp. III55–III73.

2.Muster TF, Steindi M, Purtscher M, Trkola A, Klima A, Himmler G, et al. A conserved neutralizing epitope on gp41 of human immunodeficiency virus type 1. J Virol 1993, 67:6642–6647.

3.Oldstone MB, A Tishon, H Lewick. Mapping the anatomy of the immunodominant domain of the HIV gp41 transmembrane protein, peptide conformation analysis using monoclonal antibodies and protein nuclear magnetic resonance spectroscopy. J Virol 1991, 65:1727–1734.

4.Kliger Y, Shai Y. Inhibition of HIV-1 entry before gp41 folds into its fusion active confonformation. J Mol Biol 2000, 295:163–168.

5.Rimsky LT, Shugars DC, Matthews TJ. Determinants of human immummunodeficiency virus type 1 resistance to gp41-derived inhibitory peptides. J Virol 1998, 72:986–993.

6.Labrosse B, Treboute C, Alizon M. Sensitivity to a non-peptidic compound (RPR103611) blocking human immunodeficicency virus type 1 env-mediated fusion depends on sequence and accesibility of the gp41 loop region. J Virol 2000, 74: 2142–2150.

7.McCutchan FE. Understanding the genetic diversity of HIV-1. AIDS 2000, 14 (Suppl. 3):S31–S44.

8.Thomson MM, Delgado E, Manjon N, Ocampo A, Villahermosa ML, Mariño A, et al. HIV-1 genetic diversity in Galicia Spain: BG intersubtype recombinant viruses circulating among injecting drug users. AIDS 2000, 15:509–516.

9.Perez-Alvarez L, Villahermosa ML, Carmona R, Thomson MM, Medrano L, Cuevas MT, et al. Non-B and recombinant HIV strains detected in newly diagnosed patients during 2001 in Galicia, North-Western Spain. In: XIVth International AIDS Conference. Barcelona, 2002 [Abstract TuPeC4813].

10.Villahermosa ML, Thomson MM, Vázquez de Parga E, Cuevas MT, Contreras G, Perez-Alvarez L. Improved conditions for extraction and amplification of human immunodeficiency virus type-1 RNA from plasma samples with low viral load. J Human Virol 2000, 3:27–34.

11.Zollner B, Feucht HH, Schroter M, Schäfer P, Plettenberg A, Stoehr A, Laufs R. Primary genotypic resistance of HIV-1 to the fusion inhibitor T-20 in long term infected patient. AIDS 2001, 15:935–937.

12.Delgado E, Thomson MM, Sierra M, Ocampo A, Miralles C. Identification of a newly characterized HIV-1 B/G intersubtype circulating recombinant form in Galicia, Spain, which exhibits a pseudotype-like virion structure. J Acquir Immune Defic Syndr 2002, 29:536–543.

13.Horal P, Svernnerholm B, Jeannson S, Rymo L, Hall WW, Whale A. Continuous epitopes of the human immunodeficiency virus type 1 (HIV-1) transmembrane glycoprotein and reactivity of human sera to synthetic peptides representing various HIV-1 isolates. J Virol 1991, 65:2718–2723.

14.Pérez-Alvarez L, Delgado E, Villahermosa ML, Cuevas MT, Garcia V, Vazquez de Parga E, et al. Biological characteristics of newly described HIV-1 BG recombinants in Spanish individuals. AIDS 2002, 16:669–680.#m AcknowledgementsThe authors would like to thank Dr José María Hernández Cochón, Conselleiro de Sanidade e Servicios Sociais, Xunta de Galicia, Dr Manuel Barral, Director Xeral de Saude Publica, and Dr José Antonio Taboada, Jefe del Servicio de Prevención y Control de Enfermedades Transmisibles, as well as Dr Francisco Parras, Secretary of the Spanish National AIDS Programme, for their support in the development of the study in Galicia.

Cited By:

This article has been cited 20 time(s).

Current Hiv Research
Recent advances in understanding the molecular mechanisms of HIV-1 entry and fusion: Revisiting current targets and considering new options for therapeutic intervention
Markovic, I; Clouse, KA
Current Hiv Research, 2(3): 223-234.

AIDS Research and Human Retroviruses
In vitro generation of HIV type 1 subtype C isolates resistant to enfuvirtide
Cilliers, T; Moore, P; Coetzer, M; Morris, L
AIDS Research and Human Retroviruses, 21(9): 776-783.

Journal of Antimicrobial Chemotherapy
Resistance to enfuvirtide, the first HIV fusion inhibitor
Greenberg, ML; Cammack, N
Journal of Antimicrobial Chemotherapy, 54(2): 333-340.
10.1093/jac/dkh330
CrossRef
Clinical Therapeutics
Enfuvirtide: A fusion inhibitor for the treatment of HIV infection
Fung, HB; Guo, Y
Clinical Therapeutics, 26(3): 352-378.

Virus Genes
Transmembrane protein polymorphisms and resistance to T-20 (Enfuvirtide, Fuzeon (R)) in HIV-1 infected therapy-naive seroconverters and AIDS patients under HAART-T-20 therapy
Morozov, VA; Morozov, AV; Schurmann, D; Jessen, H; Kuchere, C
Virus Genes, 35(2): 167-174.
10.1007/s11262-007-0098-8
CrossRef
AIDS Reviews
HIV-1 drug resistance mutations: an updated framework for the second decade of HAART
Shafer, RW; Schapiro, JM
AIDS Reviews, 10(2): 67-84.

Journal of Clinical Virology
Natural resistance-associated mutations to enfuvirtide (T20) and polymorphisms in the gp41 region of different HIV-1 genetic forms from T20 naive patients
Carmona, R; Perez-Alvarez, L; Munoz, M; Casado, G; Delgado, E; Sierra, M; Thomson, M; Vega, Y; de Parga, EV; Contreras, G; Medrano, L; Najera, R
Journal of Clinical Virology, 32(3): 248-253.
10.1016/j.jcv.2004.11.009
CrossRef
AIDS Research and Human Retroviruses
Sensitivity of HIV type 1 subtype C isolates to the entry inhibitor T-20
Cilliers, T; Patience, T; Pillay, C; Papathanasopoulos, M; Morris, L
AIDS Research and Human Retroviruses, 20(5): 477-482.

AIDS
Effect of naturally-occurring gp41 HR1 variations on susceptibility of HIV-1 to fusion inhibitors
Chinnadurai, R; Munch, J; Kirchhoff, F
AIDS, 19(): 1401-1405.

AIDS Research and Human Retroviruses
Genomic characterization of a novel HIV type 1 B/G intersubtype recombinant strain from an injecting drug user in Germany
Harris, B; Von Truchsess, I; Schatzl, HM; Devare, SG; Hackett, J
AIDS Research and Human Retroviruses, 21(7): 654-660.

Hiv Clinical Trials
Enfuvirtide: Antiretroviral class 4, drug 1
Asboe, D
Hiv Clinical Trials, 5(1): 1-6.

Journal of Antimicrobial Chemotherapy
Specific mutations in HIV-1 gp41 are associated with immunological success in HIV-1-infected patients receiving enfuvirtide treatment
Aquaro, S; D'Arrigo, R; Svicher, V; Di Perri, G; Caputo, SL; Visco-Comandini, U; Santoro, M; Bertoli, A; Mazzotta, F; Bonora, S; Tozzi, V; Bellagamba, R; Zaccarelli, M; Narciso, P; Antinori, A; Perno, CF
Journal of Antimicrobial Chemotherapy, 58(4): 714-722.
10.1093/jac/dkl306
CrossRef
AIDS Reviews
HIV antiretroviral drug resistance in Africa
Nkengasong, JN; Adje-Toure, C; Weidle, PJ
AIDS Reviews, 6(1): 4-12.

AIDS Research and Human Retroviruses
Enfuvirtide binding domain is highly conserved in non-B HIV type 1 strains from Cameroon, West Central Africa
Aghokeng, AF; Ewane, L; Awazi, B; Nanfack, A; Delaporte, E; Zekeng, L; Peeters, M
AIDS Research and Human Retroviruses, 21(5): 430-433.

AIDS Research and Human Retroviruses
Are fusion inhibitors active against all HIV variants?
Poveda, E; Rodes, B; Toro, C; Soriano, V
AIDS Research and Human Retroviruses, 20(3): 347-348.

AIDS Research and Human Retroviruses
gp41 sequence variability in HIV type 1 non-B subtypes infected patients undergoing enfuvirtide pressure
D'Arrigo, R; Ciccozzi, M; Gori, C; Montieri, S; Aquaro, S; Bellagamba, R; Boumis, E; Di Perri, G; Pizzi, D; Antinori, A; Rezza, G; Perno, CF
AIDS Research and Human Retroviruses, 23(): 1296-1302.
10.1089/aid.2007.0095
CrossRef
Current Pharmaceutical Design
Antiviral drugs that target cellular proteins may play major roles in combating HIV resistance
Provencher, VMI; Coccaro, E; Lacasse, JJ; Schang, LM
Current Pharmaceutical Design, 10(): 4081-4101.

Viruses-Basel
Escape from Human Immunodeficiency Virus Type 1 (HIV-1) Entry Inhibitors
De Feo, CJ; Weiss, CD
Viruses-Basel, 4(): 3859-3911.
10.3390/v4123859
CrossRef
JAIDS Journal of Acquired Immune Deficiency Syndromes
Infection With HIV Type 1 Group M Non-B Subtypes in Individuals Living in New York City
Achkar, JM; Burda, ST; Konings, FA; Urbanski, MM; Williams, CA; Seifen, D; Kahirimbanyi, MN; Vogler, M; Parta, M; Lupatkin, HC; Zolla-Pazner, S; Nyambi, PN
JAIDS Journal of Acquired Immune Deficiency Syndromes, 36(3): 835-844.

PDF (307)
JAIDS Journal of Acquired Immune Deficiency Syndromes
Increased Polymorphism in the HR-1 gp41 env Gene Encoding the Enfuvirtide (T-20) Target in HIV-1 Variants Harboring Multiple Antiretroviral Drug Resistance Mutations in the pol Gene
Si-Mohamed, A; Piketty, C; Tisserand, P; LeGoff, J; Weiss, L; Charpentier, C; Kazatchkine, MD; Bélec, L
JAIDS Journal of Acquired Immune Deficiency Syndromes, 44(1): 1-5.
10.1097/01.qai.0000243118.59906.f4
PDF (80) | CrossRef
Back to Top | Article Outline

© 2003 Lippincott Williams & Wilkins, Inc.

Login