Primary genotypic resistance of HIV-1 to the fusion inhibitor T-20 in long-term infected patients

Zöllner, Bernharda; Feucht, Heinz-Huberta; Schröter, Matthiasa; Schäfer, Petera; Plettenberg, Andreasb; Stoehr, Albrechtb; Laufs, Rainera

Research Letters
Author Information

aInstitut für Medizinische Mikrobiologie und Immunologie, Universitätsklinikum Hamburg-Eppendorf, Martinistrasse 52, D-20246 Hamburg, Germany; and bInstitut für Interdisziplinäre Infektiologie und Immunologie, Lohmühlenstrasse 5, D-20099 Hamburg, Germany.

Received: 12 September 2000; accepted: 30 January 2001.

Article Outline

The fusion inhibitor T-20 (DP178, pentafuside) represents a new substance class for the treatment of HIV infection. It is a short synthetic peptide corresponding to residues aa 127–162 within the transmembrane molecule gp41 of HIV-1 [1]. T-20 binds to the leucine zipper sequence (HR-1 domain) of gp41 and consequently inhibits transition to its fusion-active conformation [2], thereby blocking cell fusion and viral entry.

In our cohort, T-20 is of substantial interest for patients with failure of the currently available antiretroviral regimens. We have previously shown that only optimum treatment, including at least three sensitive drugs from at least two different substance classes, leads to the continuous suppression of the development of further resistance mutations [3]. As two resistance-associated mutations (G36S and V38M) against T-20 have already been described in vitro[4], it is important to know whether primary resistance to this drug can be detected in patients before the initiation of T-20 treatment. Therefore, we performed a cross-sectional analysis of the sequence variation in the N-terminus of the HR-1 domain, and determined the incidence of primary resistance to T-20 in long-term infected, heavily pretreated patients.

Thirty-nine caucasian patients were investigated. The duration of HIV infection was at least 5 years. They had received antiretroviral therapy for a mean of 4.6 years (range 2–12 years). T-20 resistance was determined genotypically from proviral DNA derived from peripheral blood lymphocytes. Peripheral blood lymphocytes were extracted from 10 ml ethylene diamine tetraacetic acid blood as described previously [5]. A 147 base pair region was amplified spanning a region from codons 6 to 54 of the gp41 molecule. A nested polymerase chain reaction was employed with primer pairs 1s (5′–TGGAGGAGGAGATATGAGG–3′)/2as (5′–CTACCAAGCCTCCTACTATC–3′) as external and 5s (5′–GCTTTRTTCMTTGGGTTCTT–3′)/6as (5′–CAGATGYTGTTGMGCCTC–3′) as internal primers. The amplification products were sequenced using BigDye termination chemistry on an automated sequencer (AbiPrism) with primers 5s and 6as. Both strands were sequenced and compared with a subtype B consensus sequence derived from an alignment of B sequences maintained at the Los Alamos HIV Sequence Database (accession no. X01762). In particular, codons 36 and 38 of the gp41 molecule were analysed for amino acid exchanges.

Amplification products were successfully obtained from 33 patients (84.6%). All had received nucleoside reverse transcriptase inhibitors for at least 3 years, in combination with either non-nucleoside reverse transcriptase inhibitors (n = 1), protease inhibitors (n = 23) or both classes of these compounds (n = 9). Compared with the consensus sequence, the concordance of nucleotide and amino acid sequences was 98 and 93.1% in our patients, respectively. The median sequence variation among all patients was 2/100 nucleotides (range 0-7/100) and 2/30 amino acids (range 0–5/30) across the analysed region. Of the 33 patients, none had amino acid exchanges at residues 36 and 38. Only one patient had a silent mutation at codon 36 (GGT to GGC). Therefore, primary genotypic resistance to T-20 could not be detected in any patient.

The results of our study show that primary resistance to T-20 is a rare event. A selection of G36S/V38M variants could not be detected even in long-term infected and heavily pretreated patients. This indicates that these variants do not have an advantage in terms of an immune escape during the course of infection or during previous antiretroviral treatment with drugs targeting reverse transcriptase or protease.

This has great impact on the initiation of a salvage regimen with T-20 as a component. As a result of a phase I/IIb open-label trial [6], the authors suggested that T-20 may be particularly useful in salvage regimens for patients who had failure of a previous highly active antiretroviral therapy. Our results show that T-20 represents a good alternative as a drug within salvage regimens because resistant variants were not found in pretreated patients. However, the favourable situation of T-20 primary resistance may change when T-20 is widely used in clinical practice because the transmission of T-20 resistant variants may occur as already described for other antiretroviral drugs [7]. In this case, T-20 primary resistance may not only be detectable but may also be clinically relevant even in treatment-naive patients.

Bernhard Zöllnera

Heinz-Hubert Feuchta

Matthias Schrötera

Peter Schäfera

Andreas Plettenbergb

Albrecht Stoehrb

Rainer Laufsa

Back to Top | Article Outline


1. Wild CT, Shugars DC, Greenwell TK, McDanal CB, Matthews TJ. Peptides corresponding to a predictive alpha-helical domain of HIV-1 gp41 are potent inhibitors of virus infection. Proc Natl Acad Sci U S A 1994, 91: 9770 –9774.
2. Kliger Y, Shai Y. Inhibition of HIV-1 entry before gp41 folds into its fusion-active conformation. J Mol Biol 2000, 295: 163 –168.
3. Zöllner B, Feucht HH, Weitner L, Adam A, Laufs R. Drug-resistant genotyping in HIV-1 therapy [Letter]. Lancet 1999, 354: 1120 –1121.
4. Rimsky LT, Shugars DC, Matthews TJ. Determinants of human immunodeficiency virus type 1 resistance to gp41-derived inhibitory peptides. J Virol 1998, 72: 986 –993.
5. Zöllner B, Feucht HH, Hamann A, Laufs R. Influence of exogenous interleukin-2 on isolation of human immunodeficiency virus. Microbiol Immunol 1995, 39: 117 –121.
6. Kilby JM, Hopkins S, Venetta TM. et al. Potent suppression of HIV-1 replication in humans by T-20, a peptide inhibitor of gp41-mediated virus entry. Nat Med 1998, 4: 1302 –1307.
7. Yerly S, Kaiser L, Race E, Bru JP, Perrin L. Transmission of antiretroviral-drug-resistant HIV-1 variants. Lancet 1999, 354: 729 –733.

Cited By:

This article has been cited 2 time(s).

Primary resistance mutations to fusion inhibitors and polymorphisms in gp41 sequences of HIV-1 non-B subtypes and recombinants
Villahermosa, ML; Perez-Alvarez, L; Carmona, R; Cuevas, MT; Thomson, MM; Medrano, L; Parga, EV; Delgado, E; Pedreira, JD; Nájera, R
AIDS, 17(7): 1083-1086.

JAIDS Journal of Acquired Immune Deficiency Syndromes
Uncommon Mutations at Residue Positions Critical for Enfuvirtide (T-20) Resistance in Enfuvirtide-Naive Patients Infected With Subtype B and Non-B HIV-1 Strains
Roman, F; Gonzalez, D; Lambert, C; Deroo, S; Fischer, A; Baurith, T; Staub, T; Boulmé, R; Arendt, V; Schneider, F; Hemmer, R; Schmit, J
JAIDS Journal of Acquired Immune Deficiency Syndromes, 33(2): 134-139.

PDF (3813)
Back to Top | Article Outline
© 2001 Lippincott Williams & Wilkins, Inc.