Skip Navigation LinksHome > December 22, 2000 - Volume 14 - Issue 18 > Thai Red Cross zidovudine donation program to prevent vertic...
AIDS:
Epidemiology & Social

Thai Red Cross zidovudine donation program to prevent vertical transmission of HIV: the effect of the modified ACTG 076 regimen

Thisyakorn, Usaa,b; Khongphatthanayothin, Manaa; Sirivichayakul, Suneea; Rongkavilit, Chokechaia; Poolcharoen, Wiputc; Kunanusont, Chaiyosc; Bien, Darl D.d; Phanuphak, Praphana,b

Free Access
Article Outline
Collapse Box

Author Information

From the aThai Red Cross AIDS Research Centre, Thai Red Cross Society, Bangkok, the bFaculty of Medicine, Chulalongkorn University, Bangkok, the cAIDS Division, Ministry of Public Health, Thailand and the dDaniels College of Business, University of Denver, Denver, Colorado, USA.

Correspondence to Usa Thisyakorn, MD, Thai Red Cross AIDS Research Centre, 1871 Rama IV Road, Prathumwan, Bangkok, Thailand 10330. Tel: +66 2 256 4107 9; Fax: +66 2 254 7577; E-mail: chokechai.r@chula.ac.th

Received: 9 November 1999;

revised: 29 June 2000; accepted: 22 August 2000.

Sponsorship: This study received grant support from the Save the Child's Life Charity Project, Thai Red Cross Society.

Collapse Box

Abstract

Objectives: To evaluate the impact of the modified ACTG 076 zidovudine regimen on the risk for vertical HIV transmission.

Design: Observational retrospective evaluation of a prospective cohort.

Setting: Thai Red Cross zidovudine donation program to reduce vertical HIV transmission.

Patients: HIV-infected Thai women and their offspring.

Intervention: The modified regimen consisted of 500 mg zidovudine daily during pregnancy and 300 mg zidovudine every 3 h during labor, taken orally, and 2 mg/kg zidovudine syrup four times daily for 6 weeks to infants.

Main outcome measures: Only infants with at least 1 HIV DNA polymerase chain reaction (PCR) result at age ≥ 4 weeks were included. HIV infection was defined by having at least one positive PCR at age ≥ 4 weeks. The transmission rate was calculated. Characteristics of women who did and did not transmit HIV to infants were compared.

Results: A total of 2891 women and their infants participated in the program and 726 infants of 719 women were included in the analysis. Forty-three infants were infected. The overall transmission rate was 6.0% (95% confidence interval, 4.4–8.0). There were no differences in maternal characteristics between transmitters and non-transmitters. The transmission rate in women who started zidovudine before 30 weeks’ gestation was not significantly different from that in women who started zidovudine at or after 30 weeks’ gestation: 5.7 versus 3.3%, respectively.

Conclusions: This modified zidovudine regimen is effective in reducing vertical transmission in a country with predominant subtype E infection. A donation program for preventing vertical HIV transmission can be implemented in developing countries, as in Thailand.

Back to Top | Article Outline

Introduction

Human immunodeficiency virus (HIV) infection has emerged as a major public health problem among women of childbearing age in Thailand [1–3]. According to the Thai Ministry of Public Health, the HIV seroprevalence rate in women attending antenatal clinics in 1998 was approximately 1.5%[4]. Concomitant with the high prevalence of infection among these women has been an increasing number of children infected through vertical transmission. Since it is estimated that 15 000–20 000 HIV-infected Thai women are pregnant each year and the vertical transmission rate in the absence of breast-feeding is approximately 19–25%[5,6], it is predicted that, without intervention, between 3000 and 5000 HIVinfected children will be born in Thailand each year.

The Pediatric AIDS Clinical Trials Group (ACTG) protocol 076 demonstrated that giving zidovudine to women during the second and the third trimester of pregnancy, during labor and to the infants could reduce vertical transmission of HIV by 67%[7]. Several subsequent studies confirmed this finding and showed that the infection rates of infants whose mothers received the ACTG 076 zidovudine regimen were 3.4–8.6%[8–12]. All of these reports were from the developed countries where this intervention has been successfully implemented.

With the availability of ACTG 076 results and sobered by the high prevalence of HIV-infected women, the Thai Red Cross AIDS Research Centre (TRCARC), formerly known as Thai Red Cross Society Program on AIDS, initiated the zidovudine donation campaign to prevent vertical HIV transmission in February 1996. This program is under the patronage of Her Royal Highness Princess Soamsawali. The main purpose is to procure zidovudine and offer the drug at no cost to HIV-infected pregnant women throughout Thailand. Subsequently, this has allowed us to be able to assess the feasibility of using zidovudine prophylaxis in reducing vertical HIV transmission and to evaluate its efficacy outside the context of clinical trial research.

Back to Top | Article Outline

Materials and methods

Program administration and management

The public was made aware of the zidovudine donation program periodically through mass media, with the assistance of the Thai Red Cross public relation and fund-raising committees. Donations to the fund could be made through several channels including a direct donation at the Red Cross offices, a direct deposit or transfer to the program's account, and a donation through many Red Cross's public activities. The donation is tax-deductible. TRCARC utilized this fund to purchase zidovudine in large quantities at a discounted rate. Moreover, the royal family members, the Thai Ministry of Public Health and the United Nations Children's Fund (UNICEF) also donated zidovudine for this program.

The program information and the zidovudine request forms were provided to all provincial hospitals and provincial health departments in 76 provinces throughout Thailand, and were subsequently distributed to local hospitals in their province. Physicians taking care of an HIV-infected pregnant woman could send the request form directly to TRCARC. A set of criteria as follows was used for the approval of the request:

1.The hospital must have an obstetrician and a pediatrician who will be responsible for patients’ follow-up.

2.The hospital must have an established counseling service and must exercise confidentiality and non-discrimination policies.

3.The woman should agree to bottle-feed her infant, to bring her infant for regular follow-up until 18 months of age, and to practice contraception after delivery.

4.The family should have an income below a certain level and have a relative who is willing to raise the child in the future once the parent can no longer take care of the child.

The request would be reviewed by one of the authors (U.T.). Once TRCARC approved the request, an initial 3-month supply of zidovudine was delivered to the hospital via a courier. The zidovudine regimen used in this program was modified from the ACTG 076 regimen. It consisted of antepartum zidovudine (200 mg in the morning and 300 mg in the evening) beginning at 14–34 weeks’ gestation plus intrapartum zidovudine (300 mg orally every 3 h until delivery) plus zidovudine for the infant (2 mg/kg of zidovudine syrup four times daily for 6 weeks). Health care providers were advised to recommend formula feeding to all infants. A free 6-month supply of infant formula may be requested directly from the Thai Ministry of Public Health.

The follow-up forms were filled out and returned to TRCARC in order to maintain the continuous supply of zidovudine for each woman and her expected infant. These forms contained demographic information, clinical information and laboratory results of each mother–infant pair. Maternal HIV disease was categorized by the hospital obstetrician when zidovudine was requested and again before labor, using the 1993 Revised Classification System for HIV Infection in Adolescents and Adults [13]. No patient's name was recorded on any of these forms. Only the hospital registration number was used for identification.

Back to Top | Article Outline
Laboratory evaluation
Specimen collection

TRCARC provided HIV DNA polymerase chain reaction (PCR) testing free of charge to all infants in the program. For practical purposes, HIV DNA PCR testing was performed by using the dried blood spot technique. The infant's capillary blood was obtained by a heel stick or a finger stick and was collected at delivery, 6 weeks and 6 months of age. Blood was directly placed onto Whatman filter paper No. 3 (Whatman International, Kent, England). To be sufficient, the diameter of each blood spot must be at least 5 mm. Spots were allowed to dry before putting in the envelope provided and mailing it to TRCARC laboratory where the PCR testing was performed. Although dried blood spot sampling was not mandatory, health care providers were encouraged to send the samples to TRCARC and they were advised to test infants for HIV antibody at or after 15 months of age.

Back to Top | Article Outline
Specimen preparation

Circles of dried blood spots were excised from the filter paper with a sterile, flamed 1/4-inch punch and were transferred to an individual well of a sterile 24-well plate. The filters were suspended in 1 ml of lysis buffer (0.32 mol/l sucrose, 10 mmol/l Tris-HCl pH 7.4, 5 mmol/l MgCl2 and 1% Triton X-100) and rotated at 60 r.p.m. for 15 min at room temperature [14,15]. The hemoglobin-tinged supernatant was carefully aspirated and discarded. The lysis process was repeated twice more. At the last lysis, the supernatant was removed as much as possible and the filters were transferred to a 1.5 ml screw-cap tube and were stored at -20°C or were proceeded to the DNA extraction step [15].

Back to Top | Article Outline
DNA extraction

Fifty microlitres of DNA extraction buffer (0.68% Tween20, 0.68% NP-40, 100 mg proteinase K/ml, 40 mmol/l Tris-HCl pH 8.3 and 3.75 mmol/l MgCl2) were added to an individual tube containing the processed filters. The tube was vortexed for 1 min and was then incubated in a 52°C heating block (or water bath) for 1 h. The tube was vortexed again and was heated at 98°C for 30 min. The tube was snap-cooled in ice water before being centrifuged at 14 000 r.p.m for 1 min. The sample was then stored at -20°C until the PCR process.

Back to Top | Article Outline
Polymerase chain reaction

Ten microlitres of DNA sample were subjected to a nested PCR. The sequences of the outer primers (JA17, JA20) and the inner primers (JA18, JA19) were as follows: JA17 5′TACAGGAGCAGATGATA CAG3′, JA20 5′CCAGTAAAATTAAAGCCAGG3′, JA18 5′GGAAACCAAAAATGATAGGG3′ and JA19 5′CCTACACCTGTCAACATAAT3′[16]. The PCR was carried out in the 0.2 ml thin-walled PCR tube in the GeneAmp PCR System 9600 (Perkin-Elmer Corp., Norwalk, Connecticut, USA). The 50 microlitres of reaction mixture contained 2mmol/l MgCl2, 4 microlitres 10 mmol/l deoxynucleotide triphosphate mixed, 25 pmol of each primer and 1.5 U of Taq DNA polymerase. The PCR condition for the outer primers was denaturation at 94°C for 5 min, followed by 40 cycles of denaturation at 94°C for 30 s, annealing at 50°C for 30 s and extension at 72°C for 30 s. Five microlitres from the first PCR were used for the nested PCR. The PCR condition for the inner primers was denaturation at 94°C for 5 min followed by 30 cycles of denaturation at 94°C for 30 s, annealing at 47°C for 30 s and extension at 72°C for 30 s. The autoextension cycle at 72°C for 5 min followed both PCR conditions. Ten microlitres of the product from the nested PCR were analyzed by agarose gel electrophoresis and were subsequently stained with ethidium bromide. The final results were visualized by using an ultraviolet transilluminator.

In this report, infants were classified as HIV-infected if they had at least one positive PCR test at age ≥ 4 weeks, and as HIV-uninfected if they had had no positive PCR tests with at least one negative PCR at age ≥ 4 weeks. Twins were counted as one and if their HIV PCR results were discordant they were considered as HIV-infected.

Back to Top | Article Outline
Statistical analysis

The SPSS program (SPSS Inc. Chicago, Illinois, USA) was used for data analysis. The vertical transmission rates with exact binomial 95% confidence interval (CI) were calculated. Comparisons of maternal age and duration of antepartum zidovudine use between transmitters and non-transmitters were tested for significance using a non-parametric test. Comparisons of the most recent stage of maternal HIV disease before delivery between transmitters and non-transmitters were tested for significance using the Fisher's exact test. All other comparisons were tested for significance using the chi-square test for categorized variables and the t-test for continuous variables. The odd ratios, with 95% CI, of positive HIV DNA PCR test according to the gestational age when zidovudine was initiated and the modes of delivery were assessed by the chi-square test.

Back to Top | Article Outline

Results

From June 1996 to August 1999, there were 2891 HIV-infected pregnant women and their infants who received zidovudine through this program from 81 hospitals in 40 provinces. Of 2891 mother–infant pairs, 1117 had sufficient dried blood spot samples for HIV DNA PCR received by TRCARC. Of 1117 mother–infant pairs, 719 had at least one HIV DNA PCR test on the infants at age ≥ 4 weeks. The remaining 398 only had HIV DNA PCR test(s) on the infants before 4 weeks of age.

Among the 398 mother–infant pairs that only had the PCR test(s) done before 4 weeks of age, 393 had one test and five had two tests. There were two sets of twins and their PCR tests were negative. Twenty-five infants (6.3%; 95% CI, 4.1–9.1) had positive PCR tests.

To examine whether the infants with positive HIV DNA PCR before 4 weeks of age might have a tendency of not having PCR tests repeated at age ≥ 4 weeks, we specifically looked at all infants who had PCR tests before 4 weeks of age. There were 840 infants with at least one negative PCR and 55 with at least one positive PCR before 4 weeks of age. Among 840 infants with negative PCR before 4 weeks of age, 467 (55.6%) had PCR repeated at age ≥ 4 weeks. Among 55 infants with positive PCR before 4 weeks of age, 30 (54.5%) had PCR repeated at age ≥ 4 weeks. The proportion of infants who had positive PCR before 4 weeks and subsequently had PCR repeated at 4 weeks of age was not significantly different from the proportion of infants who had negative PCR before 4 weeks and subsequently had PCR repeated at age ≥ 4 weeks (P = 0.88).

Only the 719 mother–infant pairs who had at least one HIV DNA PCR test at age ≥ 4 weeks were included for further analysis. These 719 women had given birth to 726 infants; there were 712 singletons and seven pairs of twins. All twins had negative HIV DNA PCR test results. Forty-three infants were defined as HIV-infected. Thus, the overall transmission rate was 6.0% (95% CI, 4.4–8.0). Of these 719 mother–infant pairs, 220 had at least two HIV DNA PCR tests performed on the infants at age ≥ 4 weeks. Sixteen infants in this group were HIV-infected and the transmission rate in this group was 7.3% (95% CI, 4.2–11.5).

Among these 719 women, no differences in demographic or clinical characteristics were found between the women who transmitted HIV to their infants and the women who did not (Table 1). The median gestational age when zidovudine was initiated and the median duration of zidovudine administration during antepartum period were not significantly different between these two groups.

Table 1
Table 1
Image Tools

The information of the timing when antepartum zidovudine was started was available in 629 women (Table 1). We arbitrarily used the gestation of 30 weeks as a cut-off for stratification. There were 507 women who began zidovudine before 30 weeks’ gestation, with the median gestation of 21.3 weeks. The transmission rate in this group was 5.7% (95% CI, 3.9–8.1). The remaining 122 women began zidovudine later, at or after 30 weeks’ gestation, with the median gestation of 32.9 weeks. The transmission rate in this group was 3.3% (95% CI, 0.9–8.2). The risk for transmission among women who started zidovudine at or after 30 weeks’ gestation, which appeared lower, was not significantly different from the risk of those who started zidovudine earlier, before 30 weeks’ gestation (odds ratio = 0.5; 95% CI, 0.2–1.4).

Among 719 mother–infant pairs, the modes of delivery were known in 638; 485 underwent normal vaginal delivery, 24 underwent assisted vaginal delivery, and 129 underwent cesarean section (Table 1). The transmission rates among these three groups (5.8, 8.3, and 4.7%, respectively) were not statistically significant, although there was a trend toward a lower transmission rate in the cesarean section group. Whether the cesarean section was elective or emergency was not known.

Back to Top | Article Outline

Discussion

The ACTG 076 study demonstrated that zidovudine regimen significantly lowered the risk for vertical transmission of HIV [7]. Subsequent studies from developed countries have confirmed the efficacy of this regimen [8–12]. This strategy was quickly adopted as standard of care in developed countries and was responsible for the substantial decline in pediatric AIDS cases in those countries [17]. However, because of the cost and complexity, this strategy has not been widely implemented in most of the developing world. This led to the establishment of our program to provide free zidovudine to HIV-infected pregnant women.

Although direct comparison with the historical data cannot be made, the transmission rate observed in this report was in agreement with the results described in other reports from developed countries where the ACTG 076 zidovudine regimen was implemented [8–12]. Aside from the effect of zidovudine, other factors could contribute to the low transmission observed in this report. These include the improved obstetric and neonatal care over time. It was previously reported that the decline in pediatric HIV cases had begun before zidovudine prophylaxis was widely implemented [17]. Nonetheless, the lack of a control group in our report made it impossible to evaluate the effect of these factors as well as of the modification of the zidovudine regimen upon the reduction of the transmission rate observed.

The risk for vertical transmission in cesarean section, although lower, was not significantly different from the risk observed in other modes of delivery. However, the information on whether the cesarean section was elective or emergency was not available. Previous studies suggested that elective cesarean section could further reduce the risk for vertical transmission of HIV [18,19].

The transmission rate in women who began antepartum zidovudine at or after 30 week's gestation was not different from the transmission rate in women who began zidovudine before 30 weeks’ gestation. Thus, it may not be imperative to start antepartum zidovudine as early as the second trimester or the early part of the third trimester, considering that vertical transmission mostly occurs during late pregnancy [20–23]. Our observation supports the results of other published studies on the efficacy of short-course antiretroviral prophylaxis [6,24–26]. In the previous Thai study when antepartum zidovudine was started at 36 weeks’ gestation, the transmission rate was reduced from 18.9% in the placebo group to 9.4% in the zidovudine-treatment group [6]. In the African studies of the short-course zidovudine during late pregnancy, the transmission rates in their breast-feeding population was reduced from 24.9–27.5% in the placebo groups to 15.7–18% in the zidovudine-treated groups [24,25]. Whereas a direct comparison with these studies cannot be made, the lower transmission rate among women who began zidovudine at or after 30 weeks’ gestation in our report could be secondary to several factors. These include the longer course of antepartum zidovudine started before 36 weeks’ gestation, the additional neonatal zidovudine administration, the different patient population, and the different obstetric care and infant -feeding practice.

We are aware that this program bears the following weaknesses.

First, the availability of the HIV DNA PCR result, which is the main outcome measure, was limited. When this program first started, TRCARC did not have the PCR testing facility. Furthermore, once the PCR testing became available for this program, it was not mandatory for participating physicians to send infant's dried blood spot samples and so PCR samples were not collected from a large number of infants. It is also possible that some infants were lost to follow-up or were not followed by the hospital where they were born.

Second, some selection bias may possibly have occurred in this report as some infected infants may have been identified by the first PCR before 4 weeks of age. The repeated test at or after 4 weeks of age may not have been regarded as necessary by health care providers and, as a result, may not have been done. This could have selectively excluded these infected cases from the analysis and could make the transmission rate appear lower than it actually was. However, among all infants with PCR carried out before 4 weeks of age in this report, the proportion of infants who had positive PCR before 4 weeks and subsequently had PCR repeated at age ≥ 4 weeks was not significantly different from the proportion of infants who had negative PCR before 4 weeks and had PCR repeated at age ≥ 4 weeks. This suggests that any selection bias that may have occurred was probably minimal.

Third, the information on other components of the program, such as the acceptance of antenatal HIV testing, the acceptance and adherence to medications and to bottle-feeding, was not systematically collected. Without complete information, it is difficult to evaluate all aspects of the program.

Finally, owing to the cost and inaccessibility, maternal virologic and immunologic assays were not carried out. Thus, the impact of these factors upon the risk for vertical transmission could not be evaluated. However, we believe that higher priority should be accorded to providing zidovudine than to performing additional assays with the limited funds so that one child's life might be saved.

Despite the weakness we have described above, our results have the following potentially important public health implications.

First, although the drug donation may not serve the whole society, it could be employed as one of the feasible strategies to acquire the medications needed to prevent vertical HIV transmission. It is in addition to the recent program to prevent vertical HIV transmission, implemented nation-wide by the Thai Ministry of Public Health, in which a different prophylactic regimen is used [27]. Moreover, the donation campaign itself has stimulated public awareness and has contributed to a better understanding of HIV/AIDS within the Thai society.

Second, the dried blood spot testing for HIV DNA PCR could be a useful and practical tool and it has opened the way for our large-scale sampling even in remote regions of the country. Previous studies have shown that PCR testing on dried blood spot specimens is a sensitive and specific assay for the diagnosis of HIV infection beyond the first few weeks of life, specifically by 1 month of age [28–30]. We have previously evaluated the sensitivity of the dried blood spot PCR method by using serially diluted ACH2 (cells with one HIV DNA copy per cell, NIH reagent Catalog No. 349) in normal donor EDTA whole blood. We found that the dried blood spot PCR method could detect at least 12.5 infected cells per spot with 100% sensitivity. Although we have not carried out the sensitivity with subtype E, the primers used are among the conserved region of the pol gene of both subtype B and E (S. Sirivichayakul, unpublished data).

Third, as HIV subtype E is the most predominant subtype in Thailand [31], the low transmission rate in our observation as well as in the previous study confirmed that the risk for vertical HIV subtype E transmission can be substantially reduced by zidovudine prophylaxis [6].

Finally and importantly, we demonstrated that the zidovudine prophylactic regimen remained effective in the general population outside the context of clinical trials.

In conclusion, this modified zidovudine regimen is effective against vertical HIV transmission in the predominantly subtype E-infected population. A low transmission rate was observed in the women who began zidovudine at or after 30 weeks’ gestation and this could have a positive financial benefit and implication in a resource-limited setting. Despite the negative social consequences of being infected with HIV, the Thai society continues to support funding zidovudine for these pregnant women. This helps make this drug donation program feasible and well received. This ‘community-to-community’ approach should be viewed as one of the strategies by which communities can work together to prevent vertical HIV transmission even in the developing regions of the world.

Back to Top | Article Outline

Acknowledgements

We are deeply grateful to H.R.H. Princess Soamsawali who is the patron of this program. We are indebted to Phan Wannamethee, Secretary General of Thai Red Cross Society, for his continuous support; to Vijitra Pradupkaew for secretarial assistance; and to the many contributors and fundraisers who by their donation and support made this program possible.

We acknowledge the directors, the obstetricians, the pediatricians and the health personnel from the following hospitals: Au Udom Hospital, Banbeung Hospital, Bangpakok Hospital, Bangpakok 3 Hospital, Bangrachan Hospital, Bankruart Hospital, Banprag Hospital, Borai Hospital, Burirum Hospital, Chacheungsao Hospital, Chainart Hospital, Chantarubekkha Hospital, Chiang Rai Prachanukroh Hospital, Chonburi Hospital, Christian Manorom Hospital, Chulalongkorn Hospital, Chumporn Hospital, Danchang Hospital, Galasin Hospital, Hun Ka Hospital, Hat Yai Hospital, Inburi Hospital, Kai Prajaksilapakom Hospital, Kalung Hospital, Kampangpetch Hospital, Kao Kichakut Hospital, Kao Sugim Hospital, Klang Hospital, Kon Kaen Hospital, Krabi Hospital, Ku Meung Hospital, Kumpawapee Hospital, Lahansai Hospital, Lertsin Hospital, Leuy Hospital, Lopburi Hospital, Maharaj Nakornrajsrima Hospital, Maharaj Nakornsrithammaraj Hospital, Na Duang Hospital, Nakornping Hospital, Nakorn Prathom Hospital, Napalai Hospital, Na Poh Hospital, Nawamin Hospital, Nongkai Hospital, Noparutrajthani Hospital, Pak-nam Chumporn Hospital, Panomsarakam Hospital, Payao Hospital, Police Hospital, Pongnamron Hospital, Potharam Hospital, Prajomklao Hospital, Prajuapkirikhan Hospital, Pramongkutklao Hospital, Praputhabaht Hospital, Sakonnakorn Hospital, Samutprakarn Hospital, Sanamchaiket Hospital, Sankaburi Hospital, Sapasitprasong Hospital, Saraburi Hospital, Satuk Hospital, Singhburi Hospital, Sirinthorn Hospital, Soi Dao Hospital, Somdejprabaromrajthewi at Sriracha Hospital, Somdejpraputalertla Hospital, Somdejprasankaraj 17 Hospital, Somdejprayuparaj Swangdandin Hospital, Songklanakarin Hospital, Suratthani Hospital, Thammasart Hospital, Tha Takiab Hospital, Thonburi Hospital, Trad Hospital, Udornthani Hospital, Utaradit Hospital, Wachira Phuket Hospital, Watsingh Hospital, and Yasothorn Hospital.

Note: Presented in part at the Second Conference on Global Strategies for the Prevention of HIV Transmission from Mothers to Infants. Montreal, Canada, 1–6 September, 1999 (Abstract 100).

Back to Top | Article Outline

References

1. Weniger BG, Limpakarnjanarat K, Ungchusak K. et al. The epidemiology of HIV infection and AIDS in Thailand. AIDS 1991, 5 (suppl 2): S71 –S85.

2. Sittitrai W, Brown T. Risk factors for HIV infection in Thailand. AIDS 1994, 8 (suppl 2): S143 –S153.

3. Mastro TD, Zhang K, Panda S, Nelson KE. HIV infection and AIDS in Asia. In:Pediatric AIDS: The Challenge of HIV Infection in Infants, Children and Adolescents. Edited by Pizzo PA, Wilfert CM. Baltimore: Williams & Wilkins; 1998: 47 –63.

4. Poonchareon W, Dilokwitayarat L. Current situations and trends of HIV infection in Thailand. Presented at 7th National Seminar on AIDS. Bangkok. April 21–23, 1999.

5. Shaffer N, Roongpisuthipong A, Siriwasin W. et al. Maternal viral load and perinatal human immunodeficiency virus type 1 subtype E transmission, Thailand. J Infect Dis 1999, 179: 590 –599.

6. Shaffer N, Chuachoowong R, Mock PA. et al. Short-course zidovudine for perinatal HIV-1 transmission in Bangkok, Thailand: a randomised controlled trial. Lancet 1999, 353: 773 –780.

7. Sperling RS, Shapiro DE, Coombs RW. et al. Maternal viral load, zidovudine treatment, and the risk of transmission of human immunodeficiency virus type 1 from mother to infant. N Engl J Med 1996, 335: 1621 –1629.

8. Fiscus S, Adimora AA, Schoenbach VJ, Wilfert C, Johnson VA. Can zidovudine monotherapy continue to reduce perinatal HIV transmission? The North Carolina experience 1993–1997. XII International Conference on AIDS. Geneva, June 28–July 3 1998 [abstract 33162].

9. Van Dyke RB, Korber BT, Popek E. et al. The Ariel project: a prospective cohort study of maternal-child transmission of human immunodeficiency virus type 1 in the era of maternal antiretroviral therapy. J Infect Dis 1999, 179: 319 –328.

10. Cooper ER, Nugent RP, Diaz C. et al. After AIDS Clinical Trial 076: the changing pattern of zidovudine use during pregnancy, and the subsequent reduction in the vertical transmission of human immunodeficiency virus in a cohort of infected women and their infants. J Infect Dis 1996, 174: 1207 –1211.

11. Wade NA, Birkhead GS, Warren BL. et al. Abbreviated regimens of zidovudine prophylaxis and perinatal transmission of the human immunodeficiency virus. N Engl J Med 1998, 339: 1409 –1414.

12. Dickover RE, Dillon M, Leung K. et al. Early prognostic indicators in primary perinatal human immunodeficiency virus type 1 infection: importance of viral DNA and the timing of transmission on long-term outcome. J Infect Dis 1998, 178: 375 –387.

13. Centers for Disease Control and Prevention. 1993 revised classification system for HIV infection and expanded surveillance case definition for AIDS among adolescents and adults. MMWR 1992, 41 (RR–17): 1 –19.

14. Buffone GJ, Darlington GJ. Isolation of DNA from biological specimens without extraction with phenol. Clin Chem 1985, 31: 164 –165.

15. Yourno J, Conroy J. A novel polymerase chain reaction method for detection of human immunodeficiency virus in dried blood spots on filter paper. J Clin Microbiol 1992, 30: 2887 –2892.

16. Albert J, Fenyo EM. Simple, sensitive, and specific detection of human immunodeficiency virus type 1 in clinical specimens by polymerase chain reaction with nested primers. J Clin Microbiol 1990, 28: 1560 –1564.

17. Lindegren ML, Byers, Jr RH, Thomas P. et al. Trends in perinatal transmission of HIV/AIDS in the United States. JAMA 1999, 282: 531 –538.

18. The European Mode of Delivery Collaboration. Elective caesarean-section versus vaginal delivery in prevention of vertical HIV-1 transmission: a randomized clinical trial. Lancet 1999, 353: 1035 –1039.

19. The International Perinatal HIV Group. The mode of delivery and the risk of vertical transmission of human immunodeficiency virus type 1. N Engl J Med 1999, 340: 977 –987.

20. Rouzioux C, Costagliola D, Burgard M. et al. Estimated timing of mother-to-child human immunodeficiency virus type 1 (HIV-1) transmission by use of a Markov model. Am J Epidemiol 1995, 142: 1330 –1337.

21. Mock PA, Shaffer N, Bhadrakom C. et al. Maternal viral load and timing of mother-to-child HIV transmission, Bangkok, Thailand. AIDS 1999, 13: 407 –414.

22. Simonon A, Lepage P, Karita E. et al. An assessment of the timing of mother-to-child transmission of human immunodeficiency virus type 1 by means of polymerase chain reaction. J Acquir Immune Defic Syndr 1994, 7: 952 –957.

23. Bertolli J, St. Louis ME, Simonds RJ. et al. Estimating the timing of mother-to-child transmission of human immunodeficiency virus in a breast-feeding population in Kinshasa, Zaire. J Infect Dis 1996, 174: 722 –726.

24. Wiktor SZ, Ekpini E, Karon JM. et al. Short-course oral zidovudine for prevention of mother-to-child transmission of HIV-1 in Abidjan, Côte d'Ivoire: a randomised trial. Lancet 1999, 353: 781 –785.

25. Dabis F, Msellati P, Meda N. et al. 6-month efficacy, tolerance, and acceptability of a short regimen of oral zidovudine to reduce vertical transmission of HIV in breastfed children in Côte d'Ivoire and Burkina Faso: a double-blind placebo-controlled multicentre trial. Lancet 1999, 353: 786 –792.

26. Guay LA, Musoke P, Fleming T. et al. Intrapartum and neonatal single-dose nevirapine compared with zidovudine for prevention of mother-to-child transmission of HIV-1 in Kampala, Uganda: HIVNET 012 randomised trial. Lancet 1999, 354: 795 –802.

27. Thaineua V, Sirinirund P, Kanshana S, et al. Scaling up: from pilot projects and clinical trials to a nationwide mother-to-child HIV transmission prevention program in Thailand. XIII International AIDS Conference. Durban, 9–14 July 2000 [abstract WeOrC619].

28. Comeau AM, Pitt J, Hillyer GV. et al. Early detection of human immunodeficiency virus on dried blood spot specimens: sensitivity across serial specimens. J Pediatr 1996, 129: 111 –118.

29. Cassol S, Butcher A, Kinard S. et al. Rapid screening for early detection of mother-to-child transmission of human immunodeficiency virus type 1. J Clin Microbiol 1994, 32: 2641 –2645.

30. Cassol S, Lapointe N, Salas T. et al. Diagnosis of vertical HIV-1 transmission using the polymerase chain reaction and dried blood spot specimens. J Acquir Immune Defic Syndr 1996, 5: 113 –119.

31. Workshop report from the European Commission (DG XII, Workshop report from the European Commission (DG XII, INCO-DC) and the Joint United Nations Programme on HIV/AIDS. HIV-1 subtypes: implications for epidemiology, pathogenicity, vaccines and diagnostics. AIDS 1997, 11: UNAIDS17 –UNAIDS36.

Keywords:

HIV; vertical transmission; zidovudine

© 2000 Lippincott Williams & Wilkins, Inc.

Login

Search for Similar Articles
You may search for similar articles that contain these same keywords or you may modify the keyword list to augment your search.