Skip Navigation LinksHome > August 11, 1997 - Volume 11 - Issue 10 > Homozygous Δ32 deletion of the CCR‐5 chemokine receptor gene...
Text sizing:
A
A
A
AIDS:
Fast Track

Homozygous Δ32 deletion of the CCR‐5 chemokine receptor gene in an HIV‐1‐infected patient

Balotta, Claudia1,5; Bagnarelli, Patrizia2; Violin, Michela1; Ridolfo, Anna Lisa1; Zhou, Dan1; Berlusconi, Alberto1; Corvasce, Stefano1; Corbellino, Mario1; Clementi, Massimo3; Clerici, Mario4; Moroni, Mauro1; Galli, Massimo1

Free Access
Article Outline
Collapse Box

Author Information

1Clinica delle Malattie Infettive, Università di Milano, Ospedale Luigi Sacco, Milan, Italy

2Istituto di Microbiologia, Università di Ancona, Ancona, Italy

3Dipartimento di Scienze Biomediche, Università di Trieste, Trieste, Italy

4Cattedra di Immunologia, Università di Milano, Padiglione LITA, Ospedale Luigi Sacco, Milan, Italy.

5Requests for reprints to: Dr Claudia Balotta, Clinica delle Malattie Infettive, Università di Milano, Ospedale Luigi Sacco, Via G.B. Grassi 74, 20157 Milano, Italy.

Sponsorship: This work was supported by grants from Istituto Superiore di Sanità, IX Progetto AIDS no. 9404-78 (C.B.), no. 9304-39 (M. Clementi), no. 9304-34 (M. Clerici), no. 9402-10 (M.G.) and no. 9403-78 (M.M.).

Date of receipt: 28 April 1997; accepted: 22 May 1997.

Collapse Box

Abstract

Background: Recent research has found that entry of non-syncytium-inducing (NSI), monocyte-macrophage-tropic HIV-1 isolates requires binding to both CD4 and CCR5 receptors, and that Δ32/Δ32 homozygous individuals are protected against infection.

Objective: To analyse the polymorphism of CCR-5 gene in HIV-1-infected and uninfected subjects.

Design and methods: CCR-5 sequences were amplified by polymerase chain reaction (PCR) from DNA of peripheral blood mononuclear cells. Samples from 152 HIV-1-infected subjects and 122 uninfected controls were tested for the detection of the 32 base-pair deletion. HIV-1 phenotype was determined by viral isolation and MT-2 evaluation.

Results: The wild-type/Δ32 heterozygous and Δ32/Δ32 homozygous conditions were represented in 10.7 and 0.8% of healthy controls and in 9.8 and 0.7% of HIV-1-infected subjects, respectively. Of note, the Δ32/Δ32 deletion of the CCR-5 gene was detected by PCR and sequencing confirmed in a patient with progressive infection harbouring a clade B virus with SI phenotype.

Conclusions: Δ32/Δ32 homozygosity for the CCR-5 gene does not confer absolute protection against HIV-1 infection, suggesting that either macrophage-tropic viral strains could use coreceptors other than CCR-5 or infect independently of the presence of a functional CCR-5 coreceptor. Alternatively, primary infection sustained by T-cell-tropic isolates, although exceptional, may occur.

Back to Top | Article Outline

Introduction

The interaction of HIV-1 with two distinct coreceptors, the α-chemokine receptor CXCR-4 (previously designated LESTR/fusin) [1–3] and a member of the family of β-chemokines receptors, CCR-5 [4–7], has recently been demonstrated. It has also been observed that T-cell-tropic variants of HIV-1 specifically interact with the CXCR-4 molecule, whereas monocyte-macrophage strains primarily use CCR-5 [8–11].

In Caucasians, a 32-nucleotide deletion (Δ32) may be present in one or both alleles of CCR-5 gene, and it has been suggested that (i) the deletion on both alleles (Δ32/Δ32) prevents HIV-1 penetration into target cells and therefore infection [8,9], and (ii) the deletion in one of the two alleles of the CCR-5 gene (wild-type/Δ32) is associated with a more benign pattern of disease progression [10,11].

Previous studies have demonstrated that nonsyncytium-inducing (NSI), macrophage-tropic strains predominate in the primary and early asymptomatic phases of HIV-1 infection, suggesting a common biological phenotype of viral species after transmission and selection [12]; subsequently, syncytium-inducing (SI) variants may emerge and cause rapid CD4 T-cell depletion and progression to AIDS [13,14] at least in 50–60% of HIV-1-infected individuals. Moreover, this occurs irrespective of HIV-1 transmission modalities (i.e., parenteral or sexual) and of the viral phenotype of the transmitter [12,15,16].

In this study we evaluated the prevalence of the wild-type/Δ32 genotype in a cohort of Italian HIV-1-seropositive individuals. Samples from 152 HIV-1-seropositive subjects and 122 HIV-1-seronegative blood donors were analysed. The occurrence of HIV-1 NSI or SI phenotype and risk factor in both wild-type and heterozygous CCR-5 individuals was also studied.

Back to Top | Article Outline

Materials and methods

HIV-1-infected and uninfected subjects

Samples from 122 blood donors were obtained from the Transfusion Service, Department of Immuno-Haematology, L. Sacco Hospital; 152 HIV-1-infected individuals were consecutively enrolled amongst the outpatients of the Clinic of Infectious Diseases, University of Milan.

Back to Top | Article Outline
CCR-5 gene amplification and sequencing

A portion of the CCR-5 gene was amplified by polymerase chain reaction (PCR) from genomic DNA and analysed using 10% polyacrylamide gel electrophoresis.

Primers SP4.760 and PM6.942, flanking the 32 base-pair deletion were used to obtain the wild-type (183 base pairs) and deleted fragments (151 base pairs). The PCR reaction mixture and the thermal profile have been described elsewhere [9]. A control amplification containing no added DNA was included in each set of amplifications.

Back to Top | Article Outline
HIV-1 V1–V5 env region amplification, cloning and sequencing

Genomic DNA from the HIV-1-infected patient who tested Δ32/Δ32 homozygous was analysed by nested PCR, cloning and sequencing to characterize the entire V1–V5 gp120 env region. First round primers were CB01 (5′ CTAGAGCCCTGGAAGCATCCAGGA AG 3′; nucleotides 5866–891 of HIV-1MN reference strain) and CB06 (5′ AATAGAGTTAGGCAGGGA TACTCAC 3′, nucleotides 8357–8381). The second round primers were CB03 (5′ CCATGTGTAAAA TAACCCCACTC 3′, nucleotides 6587–6610) and CB04 (5′ GGAGCAGCAGGAAGCACTATGGGCG 3′, nucleotides 7811–7835). Amplifications were performed in a 50 µl reaction mixture containing 1 µg DNA, 0.2 mmol/l dNTP, 20 pmol of the outer primers, and 2.5 U Taq polymerase (Perkin Elmer, Norwalk, Connecticut, USA). Thirty cycles were carried out, two consisting of 30 sec at 98°C, 2 min at 55°C, and 1 min 30 sec at 72°C, followed by 28 cycles of 30 sec at 92°C, 30 sec at 55°C, and 1 min 30 sec at 72°C, with a final extension of 15 min at 72°C. Two microlitres of amplified DNA were used as a template for the nested PCR. Forty cycles were run, two at 98°C for 30 sec, and 64°C for 2 min 30 sec, and 38 cycles at 92°C for 30 sec, and 64°C for 2 min, with a final extension of 15 min at 72°C. The PCR products were purified with the Qiaquick spin PCR purification kit (Qiagen, Dusseldorf, Germany) according to the manufacturer's protocol. PCR-purified products were cloned with the TA Cloning System Kit (Invitrogen, San Diego, California, USA) following the manufacturer's instructions. Plasmid DNA was extracted by means of the Qiaprep spin plasmid miniprep kit (Qiagen). The presence and the size of the insert in the plasmid clones were verified by restriction enzyme analysis. Clones were sequenced on both strands with fluorescent dye-labelled terminators using an Applied Biosystems model 373A DNA sequencer (Perkin-Elmer, Applied Biosystems Inc., Foster City, California, USA). DNA sequences were analysed and assembled using Sequence Navigator (Applied Biosystems) software on Macintosh computers. A detailed sequencing protocol is available upon request.

Back to Top | Article Outline
Analysis of sequence data

Phylogenetic tree of HIV-1 env sequence was prepared using the neighbour joining method using DNASTAR software (DNASTAR Inc., Madison, Wisconsin, USA). The nucleotide sequence of HIV-1 V1–V5 env sequences of the patient (R.M.) has been assigned Gen Bank accession number U92491.

Back to Top | Article Outline
HIV-1 isolation, phenotype evaluation and plasma viraemia detection

Peripheral blood mononuclear cells (PBMC) from HIV-1-infected subjects were isolated on lymphocyte separation medium by standard gradient-based procedures. HIV-1 was isolated by cocultivation [17]. HIV-1 p24 antigen was assayed in culture supernatants using a commercial enzyme-linked immunosorbent assay (DuPont de Nemours, Wilmington, Delaware, USA). Virus phenotype was tested in primary cocultures as previously described [17]. The genomic HIV-1 RNA present in plasma samples was extracted and amplified by high sensitivity quantitative procedures as described elsewhere [18].

Back to Top | Article Outline
Statistical analysis

The genetic and virological data were analysed using χ2 test with Yates' correction, and Fisher's exact test was performed to compare proportions between the groups.

Back to Top | Article Outline

Results

HIV-1-infected individuals represented a consecutive series of outpatients with CD4 cell counts ranging from 1–1735 × 106/l (median, 167 × 106/l; SE, 21.8), 71 (46.4%) of whom had been infected by the parenteral route and 82 (53.6%) by sexual contact. Eighty-two HIV-1-infected subjects showed CD4 counts below 200 × 106/l, 50 had 200–500 × 106/l, and 20 above 500 × 106/l. Five out of 152 patients resulted isolation-negative, whereas 73.2% of patients harboured a virus of NSI phenotype and the remaining 23.5% showed the presence of SI variants. Table 1 shows that the prevalence of CCR-5 wild-type/Δ32 was not significantly different when HIV-1-seropositive individuals were compared with HIV-1-seronegative controls. Likewise, no correlations emerged when CCR-5 geno-type status was related to CD4 cell counts or viral phenotype, because comparable proportions of subjects showed wild-type or heterozygosity condition of the CCR-5 gene (Table 1). Moreover, the distribution of Δ32 allele was not significantly different in subjects infected through parenteral or sexual route (Table 1).

Table 1
Table 1
Image Tools

Of note, one CCR-5 Δ32/Δ32 HIV-1-infected subject was found in our population (Fig. 1); this patient is a 36 year-old Italian homosexual man, who seroconverted before 1988 and came to our attention in 1994 showing low CD4 count (87 × 106/l) and a plasma viraemia of 14 664 RNA copies/ml. The homozygous deletion was confirmed by sequence analysis of the CCR-5 gene, as shown in Fig. 1. This individual was further investigated by viral phenotyping and sequence of the env gene. HIV-1 viral isolation and phenotype assessment were performed in 1994 and 1997 showing the presence of SI variants, which were detected in both primary PBMC and the MT-2 cell line. HIV-1 DNA sequences from PBMC encompassing the V1–V5 region of the env gene were amplified, cloned and sequenced. Phylogenetic analysis revealed the presence of a clade B HIV-1 virus (Fig. 2).

Fig. 1
Fig. 1
Image Tools
Fig. 2
Fig. 2
Image Tools
Back to Top | Article Outline

Discussion

Our results obtained from blood donors in Milan are comparable to those reported by Huang et al. [10] from blood donors living in New York City, suggesting a similar distribution of the Δ32 allele in individuals of Caucasian descent world-wide. However, these authors suggested a possible role of Δ32/Δ32 deletion in the protection against HIV-1 infection, since they reported the absence of this homozygous condition in several hundred HIV-1-infected subjects [10,11] and a higher prevalence in exposed uninfected individuals than in unexposed healthy controls [10].

Given the assumption that CXCR-4 and CCR-5 coreceptors are needed for HIV-1 entry into target cells, the lack of a functional CCR-5 coreceptor should prevent infection carried by macrophage-tropic isolates. Indeed, in vivo studies have suggested that individuals carrying a homozygous frame-shifting deletion for the CCR-5 gene are protected against HIV-1 infection [8,9].

However, a recent study has indicated that cofactors other than CCR-5 may be involved in viral entry into primary macrophage systems [19]. Even more relevantly, a CCR-5 Δ32/Δ32 HIV-1-infected subject with progressive HIV-1 disease has recently been described [20]. Our finding of a Δ32/Δ32 homozygous HIV-1-infected subject offers further support to the evidence that the deletion of the main HIV-1 coreceptor for primary infection is not associated with absolute protection against HIV-1 transmission. This observation is even more interesting when one considers that despite the heterogeneity of the viral inoculum, the phenotype of viral population supporting primary infection was shown to be preferentially macrophage-tropic and CCR-5-dependent. Far from being conclusive, this finding suggests multiple, alternative possibilities deserving further investigations: (i) macrophage-tropic HIV-1 strains could use coreceptors other than CCR-5; (ii) macrophage-tropic HIV-1 strains could infect independently of the need for a coreceptor; (iii) certain variants of macrophage-tropic HIV-1 strains could use different portals of entry into target cells; or (iv) although against mainstream evidence and uncommon, primary infection could be sustained by T-cell-tropic strains. In fact, we cannot exclude that HIV-1 SI variants were responsible for primary infection in our patient, even if this is unlikely, given that the virus was acquired by the sexual route.

In this study, we found a comparable distribution of wild-type/Δ32 genotype in HIV-1-infected individuals stratified according to CD4 cell counts and virus phenotype. Given that the presence of cytopathic variants and lower CD4 cell counts correlate with disease progression, this study does not support the hypothesis that a wild-type/Δ32 heterozygous condition is associated with delayed progression. Moreover, Huang et al. [10] reported that although wild-type/Δ32 status was associated with lower CD4 decline and plasma viraemia levels, no correlation was found with AIDS-free survival time. Therefore, a larger number of HIV-1-infected individuals of different geographical distribution needs to be studied to definitively assess the correlation between wild-type/Δ32 status and delayed progression in HIV-1 infection.

In conclusion, this study shows a similar prevalence of wild-type/Δ32 and Δ32/Δ32 polymorphism in HIV-1-infected and uninfected populations and strongly supports the evidence that Δ32/Δ32 homozygous deletion in the CCR-5 gene does not confer absolute protection from HIV-1 infection, indicating that the interaction between the virus and its cellular receptors warrants additional, more accurate analyses. In this context, genetic, viral and host factors should be considered in designing a comprehensive model of HIV-1 infection and, possibly, therapeutical strategies.

Back to Top | Article Outline

Acknowledgement

We are grateful to R.M., whose generosity permitted this study. We are indebted to the Transfusion Service, Department of Immuno-Haematology at the L. Sacco Hospital for the supply of donor buffy coats.

Back to Top | Article Outline

References

1. Feng Y, Broder CC, Kennedy PE, Berger EA: HIV-1 entry cofactor: functional cDNA cloning of a seven-transmembrane, G protein-coupled receptor. Science 1996, 272:872–877.

2. 2. Oberlin E, Amara A, Bachelerie F, et al.: The CXC chemokine SDF-1 is the ligand for LESTR/fusin and prevents infection by T = cell-line-adapted HIV-1. Nature 1996, 382:833–835.

3. Bleul CC, Parolin C, Clark-Lewis I, et al.: The lymphocyte chemoattractant SDF-1 is a ligand for LESTR/fusin and blocks HIV-1 entry. Nature 1996, 382:829–832.

4. Dragic T, Litvin V, Allaway GP, et al.: HIV-1 entry into CD4+ cells is mediated by the chemokine receptor CC-CKR-5. Nature 1996, 381:667–673.

5. Deng H, Liu R, Ellmeier W, et al.: Identification of a major co = receptor for primary isolates of HIV-1. Nature 1996, 381:661–667.

6. Alkhatib G, Combadiere C, Broder CC, et al.: CC CKR5: a RANTES, MIP-1α, MIP-1β receptor as a fusion cofactor for macrophage-tropic HIV-1. Science 1996, 272:1955–1958.

7. Doranz BJ, Rucker J, Yi Y, et al.: A dual-tropic primary HIV-1 isolate that uses fusin and the beta-chemokine receptors CKR-5, CKR-3, and CKR-2b as fusion cofactors. Cell 1996, 85:1149–1158.

8. Samson M, Libert F, Dorantz BJ, et al.: Resistance to HIV-1 infection in Caucasian individuals bearing mutant alleles of the CCR-5 chemokine receptor gene. Nature 1996, 382:722–725.

9. Liu R, Paxton WA, Choe S, et al.: Homozygous defect in HIV-1 coreceptor accounts for resistance of some multiply-exposed individuals to HIV-1 infection. Cell 1996, 86:367–377.

10. Huang Y, Paxton WA, Wolinsky SM, et al.: The role of a mutant CCR5 allele in HIV-1 transmission and disease progression. Nature Med 1996, 2:1240–1243.

11. Dean M, Carrington M, Winkler C, et al.: Genetic restriction of HIV-1 infection and progression to AIDS by a detection allele of the CKR5 structural gene. Science 1996, 273:1856–1862.

12. Zhu T, Mo H, Wang N, et al.: Genotypic and phenotypic characterization of HIV-1 in patients with primary infection. Science 1993, 261:1179–1181.

13. Koot M, Keet IPM, Vos AVH, et al.: Prognostic value of human immunodeficiency virus type 1 biological phenotype for rate of CD4 depletion and progression to AIDS. Ann Intern Med 1993, 118:681–688.

14. Schuitemaker H, Koot M, Kootstra NA, et al.: Biological pheno = type of human immunodeficiency virus type 1 clones at different stages of infection: progression of disease is associated with a shift from monocyte-tropic to T-cell tropic virus population. J Virol 1992, 66:1354–1360.

15. Spijkerman IJB, Koot M, Prins M, et al.: Lower prevalence and incidence of HIV-1 syncytium-inducing phenotype among injecting drug users compared with homosexual men. AIDS 1995, 9:1085–1092.

16. van't Wout AB, Kootstra NA, Mulder-Kampinga GA, et al.: Macrophage-tropic variants initiate human immunodeficiency virus type 1 infection after sexual, parenteral, and vertical transmission. J Clin Invest 1994, 94:2060–2067.

17. Balotta C, Viganò A, Riva C, et al.: HIV-1 phenotype correlates with the stage of infection in vertically infected children. AIDS Res Hum Retroviruses 1996, 12:1247–1253.

18. Bagnarelli P, Valenza A, Menzo S, et al.: Dynamics of molecular parameters of human immunodeficiency virus type 1 activity in vivo. J Virol 1994, 68:2495–2502.

19. Cheng-Mayer C, Liu R, Landau NR, Stamatatos L: Macrophage tropism of human immunodeficiency virus type 1 and utilization of the CC-CKR5 coreceptor. J Virol 1997, 71:1657–1661.

20. Biti R, French R, Young J, Bennetts B, Stewart G: HIV-1 infection in an individual homozygous for the CCR5 deletion allele. Nature Med 1997, 3:252–253.

Keywords:

CCR-5 gene; Δ32/Δ32 deletion; HIV-1 non-syncytium-inducing/macrophage-tropic isolates; HIV-1 syncytium-inducing/T-cell-tropic isolates

© Lippincott-Raven Publishers.

Login

Search for Similar Articles
You may search for similar articles that contain these same keywords or you may modify the keyword list to augment your search.